Resúmenes

XXII Congreso Sociedad Chilena de Fitopatología

23, 24 y 25 de Septiembre de 2013
Viña del Mar – Chile

 

 

Detección de Ralstonia solanacearum agente causal de marchitez bacteriana de la papa en la Región de La Araucanía

1 Lillo, C.; 1Moreira, S.; 2 Vega, E.; 2 Soto, C.; 3 Saavedra, I.; 3Mora, J.C.; 3 Sepúlveda, P.; 4 Seguel, M. 1 Laboratorio Fitopatología Araucanía, 2 Laboratorio Bacteriología Lo Aguirre, 3 Protección Agrícola y Forestal, 4 Recursos Naturales Renovables. Servicio Agrícola y Ganadero E-mail: claudio.lillo@sag.gob.cl

La marchitez bacteriana de la papa causada por Ralstonia solanacearum, es una de las principales enfermedades en el cultivo de la papa en el mundo, el agente causal es considerado cuarentenario presente en Chile para el biovar 2 y cuarentenario ausente para el resto de los biovares. El biovar 2 se ha detectado en Chile en forma esporádica entre la Región de Coquimbo y del Maule, estableciéndose un área libre que comprende las regiones del Bío Bío (provincia de Arauco), Araucanía, Los Ríos, Los Lagos, Aysén y Magallanes. En La Araucanía se había detectado presión de ingreso en labores de vigilancia del Programa Nacional de Sanidad de la Papa realizada en el año 2009 y dos intercepciones en comercio en el año 2010. Dadas las condiciones climáticas del sur del país se esperaba que la enfermedad se presentara de forma asintomática, sin embargo en la temporada 2012-2013 en labores de vigilancia se encontró plantas marchitas y tubérculos con presencia de pequeñas fisuras y necrosis asociada a yemas y estolón. Al realizar un corte frontal de los tubérculos se encontró pardeamiento asociado al anillo vascular, necrosis y en algunos casos exudados atribuibles a bacterias. Se determinó la presencia de Ralstonia solanacearum mediante la técnica ELISA (kit Loewe), la bacteria fue cultivada en medio Kelman CTT. Los resultados obtenidos fueron confirmados mediante PCR en el laboratorio de Bacteriología Lo Aguirre donde fue sometida a pruebas biológicas y bioquímicas determinándose que correspondía a la raza 3, biovar 2, resultado confirmado por secuenciación de ADN. Se ha identificado dos orígenes de material de propagación infectado que ha originado la dispersión, afectando los cultivares Asterix, Desireé, Karú, Pukara, Rodeo y Yagana. Se ha cuarentenado los predios positivos y se trabaja activamente en vigilancia, epidemiología y un plan estratégico multidisciplinario regional para contener y erradicar la enfermedad.

Avances en la identificación de Alternaria spp. asociadas al cultivo de papa en la zona sur de Chile

Acuña I.; Sandoval, C.; Mancilla, S.; Cádiz, F.; Piontelli, E. Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación Remehue E-mail: iacuna@inia.cl

Tizón temprano causado por Alternaria spp., es la segunda enfermedad de follaje más importante en el cultivo de papa en la zona Sur de Chile, pudiendo atacar con diferente severidad según el cultivar, manejo agronómico y las condiciones ambientales de la temporada, ocasionando pérdidas de hasta un 30% en cultivares susceptibles. Las distintas especies de Alternaria pueden tener requerimientos y características biológicas propias tales como: agresividad, resistencia a fungicidas, temperatura óptima de crecimiento, entre otras. Durante las últimas temporadas del cultivo, se han realizado prospecciones en la zona papera del sur de Chile, con el objetivo de identificar las especies de Alternaria asociadas al cultivo de papa mediante caracterización morfológica y molecular. Este patógeno fue aislado desde lesiones de hoja y cultivado en agar papa zanahoria para su descripción morfológica, que incluyó forma y tamaño conidial y patrón de esporulación. Como resultado, se detectaron cuatro grupos de Alternarias de esporas pequeñas (A. alternata, A. tenuissima, A. arborescens y A. infectoria) y un grupo de espora grande (A. solani). Para el análisis molecular se amplificó y secuenció la región rDNA de tres aislamientos de cada grupo morfológico detectado, identificándose tres grupos: el primero incluye todos los aislamientos de espora pequeñas, excepto A. infectoria. El segundo grupo incluye A. solani y el último corresponde a A. infectoria. Este análisis corrobora lo detectado mediante morfología. De esta manera, relacionando los resultados obtenidos con ambas metodologías se identificaron 5 grupos de Alternaria asociados al cultivo de papa en el sur de Chile: A. alternata, A. arborescens, A. tenuissima, A. infectoria y A. solani. Esta información es de relevancia para futuros estudios de patogenicidad, virulencia, resistencia a fungicidas y pruebas en campo, debido a la posibilidad de un comportamiento diferencial de cada especie.

Una década de monitoreo de Phytophthora infestans asociada al cultivo de papa en el sur de Chile

Sandoval, C.; Acuña, I.; Sagredo, B.; Fahrenkrog, A.; Gutiérrez, M.; Mancilla, S. Instituto de Investigaciones Agropecuarias, CRI-Remehue E-mail: camila.sandoval@inia.cl

Tizón tardío, causada por P. infestans, es la enfermedad más destructiva que afecta al cultivo de papa en el mundo. Este patógeno ha sido capaz de adaptarse a diferentes climas y latitudes a través de la historia, predominando nuevos biotipos en las últimas dos décadas haciendo más difícil su control. Los primeros reportes de esta enfermedad en Chile datan de la década del 50. Sin embargo, desde el 2005 la enfermedad se ha presentado con mayor incidencia y severidad en las plantaciones del sur de Chile, ocasionando pérdidas de más del 50% de la producción. Dado lo anterior, se ha realizado un monitoreo de P. infestans con el objetivo de caracterizar las poblaciones de este agente causal y determinar sus posibles cambios. Se han realizado colecciones del patógeno desde las temporadas 2003/04 hasta 2012/13 en zonas productoras de papa de la zona sur para ser analizadas mediante 9 marcadores moleculares tipo SSR y resistencia a fungicidas. Hasta la temporada 2011/12 se han detectado 24 genotipos, diferenciándose 19 genotipos entre las temporadas 2003/05, sin predominancia clara. Sin embargo, en la temporada 2006/07 se detectó un cambio en el perfil genético de las poblaciones, donde los genotipos presentes en las temporadas anteriores ya no se detectaron, siendo reemplazados por 2 genotipos nuevos. Este cambio coincide con la detección de genotipos altamente resistentes a Metalaxil con EC50 mayor a 100 ppm, presencia de patotipos más complejos en virulencia y cambios en los haplotipos mitocondriales. De esta manera, la población de P. infestans en el sur de Chile, ha experimentado cambios genéticos importantes con los años, observándose hoy en día patrones completamente distintos a las temporadas anteriores.

Detección e identificación de fitoplasmas en cultivos de papa y lechuga

1 Peña, E.; 2Gutiérrez, M.; 3 Zamorano, A.; 3 Fiore, N.; 4Cáceres, C.; 1Rosales, M. 1 Facultad de Agronomía e Ingeniería Forestal, Pontificia Universidad Católica de Chile, Santiago, Chile. 2 Servicio Agrícola y Ganadero (SAG), Laboratorio Regional Osorno, Osorno, Chile. 3 Facultad de Ciencias Agronómicas, Universidad de Chile, Santiago, Chile. 4 Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación La Platina, Santiago, Chile E-mail: irosalesv@uc.cl

Los fitoplasmas son parásitos obligados carentes de pared celular localizados en el floema de plantas y la hemolinfa de insectos vectores. Los fitoplasmas se asocian con cientos de enfermedades alrededor del mundo y causan importantes pérdidas económicas en diversos cultivos de hortalizas, ornamentales y frutales, entre otros. Síntomas asociados a presencia de fitoplasmas, tales como distorsión y deformación de hojas, acompañado en algunos casos de un arreglo en roseta hacia la zona apical de la planta fueron observados en cultivos de lechuga de la Región Metropolitana durante el invierno 2013. Por otra parte, se colectaron muestras de hojas de papa en la Región de Los Lagos durante el verano 2013, las que presentaban síntomas de enrollamiento de hojas sumado a decoloraciones amarillas y/o moradas junto con decaimiento generalizado de las plantas. Utilizando la técnica de PCR anidado se determinó la presencia de estos agentes fitopatógenos a través de mezclas de partidores que amplifican secuencias específicas del factor de elongación Tu (Tuf), un gen que codifica para una proteína involucrada en el proceso de traducción y que ha sido recientemente descrito como un marcador que permite una eficiente identificación de fitoplasmas (Makarova y cols., 2012). En ambos cultivos fue posible obtener amplicones de alrededor de 400 bp que fueron secuenciados y alineados contra bases de datos disponibles. Los alineamientos arrojaron con una similitud de cerca de 97% la presencia de fitoplasmas pertenecientes al grupo 16SrIII (X-disease group). Sin embargo, mediante ensayos de RFLP in silico con las enzimas MboI, HpaI y AluI se pudo precisar que los fitoplasmas presentes en ambos cultivos pertenecen al subgrupo 16SrIII-J, constituyendo la primera identificación de fitoplasmas en cultivos de papa y lechuga en el país. Actualmente se está confirmando la identificación a través del uso de las secuencias ribosomales que codifican para el gen 16S.

Caracterización molecular de razas del Virus Y de la papa (PVY) detectadas en muestras provenientes de la Región de La Araucanía, Los Ríos y Los Lagos

1Muñoz, M.; 2Gutierrez, M.; 3 Acuña, I.; 1Rosales, M. 1Departamento de Ciencias Vegetales, Facultad de Agronomía e Ingeniería Forestal, Pontificia Universidad Católica de Chile 2 Servicio Agrícola y Ganadero (SAG), Laboratorio Regional Osorno 3 Instituto de Investigaciones Agropecuarias (INIA), Centro Regional de Investigación Remehue E-Mail: irosalesv@uc.cl

El cultivo de papa (Solanum tuberosum L.) es altamente susceptible a problemas fitopatológicos, como infección por virus, bacterias y hongos produciendo bajas en el rendimiento y la calidad del producto final. Dentro de los géneros virales más limitantes destacan los Potyvirus, siendo PVY el virus de mayor importancia económica del grupo. Históricamente, las razas de PVY se han dividido en tres principales: PVYO (raza común, causa síntomas de mosaico), PVYN (raza necrótica en tabaco, causa síntomas leves en el follaje de papa) y PVYC (causa estriado puntiforme). Sin embargo, a partir de los años 80’s se han detectado variantes y razas recombinantes de este virus. En 1994 se caracterizó PVYNTN, serológicamente relacionada con PVYN , pero con la particularidad de causar anillos necróticos en tubérculos de papa, enfermedad conocida por sus siglas en inglés como PTNRD. PVYNTN, se origina a partir de 3 eventos de recombinación entre las razas PVYN y PVYO . Frente a esta gran diversidad genética y biológica de este agente viral, el presente trabajo tiene como objetivo realizar un estudio molecular de las razas de PVY que han sido detectadas en muestras colectadas en la Región de La Araucanía, Los Ríos y Los Lagos, entre Septiembre de 2011 y Enero de 2012, como parte de las actividades de fiscalización de semilleros y del programa de vigilancia del cultivo de papa. La caracterización molecular se realizó utilizando marcadores moleculares ubicados en diferentes regiones del genoma, específicamente en los genes HC-Pro y 6K2 (Lorenzen, 2006), y el gen P1 (Nie y Singh, 2002), de esta forma se identificaron las razas presentes en un total de 112 muestras, donde un 63,4% fueron necróticas, 16,07% raza común y un 20,53% corresponde a una infección mixta de PVYNTN y PVYO . Adicionalmente, se trabajó caracterizando los sitios de recombinación que identifican la raza NTN utilizando partidores específicos para estas regiones, ubicadas en la zona HC/Pro-P3, 6K2-NIa y finalmente la zona Cterminal de CP. Fuente de Financiamiento: FIA PYT-2011-0065.

Evaluación de la efectividad a nivel de laboratorio y campo de controladores biológicos y químicos de Phytophthora infestans en el cultivo de tomate de mesa, Solanum lycopersicum, Mill

1Galvis, C; 2 Agualimpia, B.; 3Díaz, A. 1 Facultad de Ciencias Exactas, Universidad de Santander, Bucaramanga, Colombia 2 Facultad de Ciencias Exactas, Universidad de Santander, Bucaramanga, Colombia 3Director Regional ICA. Santander, Colombia E-Mail: cgalvis@udes.edu.co

Con el fin de ofrecer una alternativa en el manejo integrado de enfermedades, específicamente de la gota o tizón tardío, producida por Phytopthora infestans, en tomate de mesa Solanum lycopersicum Miller se evaluó la actividad antagónica in vitro e in vivo de un controlador biológico comercial, Trichoderma lignorum, el fungicida Fluopicolide + Propamocarb-HCl, peróxido de hidrógeno y el activador de defensas de la planta, Monofosfito potásico. La evaluación de campo correspondió a un diseño factorial de bloques al azar con estimulación y medidas repetidas en el tiempo y la fase in vitro a un diseño factorial. Los datos obtenidos en la fase de campo se analizaron mediante las pruebas de Kruskal-Wallis, utilizando el paquete estadístico Sistema SAS 9, con un nivel de significación del 0.05, la fase de in vitro con la prueba de agrupamiento de Sheffe y Duncan, esta prueba demostró que Trichoderma lignorum, realizó inhibición significativa Pr>F <0.0001, del crecimiento radial, sobre P. infestans y un grado 4 de micoparasitismo. Agrifos, con una media de 0.19cm es el fungicida de mayor efectividad, siguiendo en orden de eficacia peróxido de hidrógeno (media: 1.20cm) e Infinito (media: 2,73 cm). En cuanto a las pruebas de campo ninguno de los tratamientos mostró diferencias significativas en su eficacia ya que el grado 5 de severidad se presentó en un 58.7% del total de los resultados. La mayor producción de tomate de mesa la presentó el tratamiento MYCOBAC + AGRIFOS con 2033 Kg/ha, el de menor costo es PEROXAL con M$18.486/ha, ningún tratamiento permitió llegar al punto de equilibrio.

¿Potencial patogenicidad en humanos por flora bacteriana presente en cultivos de jitomate?

1 Pérez, R.; 1Herrera, J.; 2Martínez, R.; 2Rivera, J. A. 1 Laboratorio de Biología Molecular y Genética. Escuela de Biología, Benemérita Universidad Autónoma de Puebla, Puebla, México 2 Departamento de Investigaciones microbiológicas. Instituto de Ciencias. Benemérita Universidad Autónoma de Puebla, Puebla. México E-Mail: rocperez33@hotmail.com

Lycopersicon lycopersicum, comúnmente conocida como jitomate, tiene importancia en México por su alto consumo en diversos alimentos. En este trabajo se describe la flora bacteriana en el Estado de Puebla, México, asociada a cultivos de jitomate en producción bajo condiciones de invernadero, colectado de las principales localidades productoras del Estado. Se extrajeron, aislaron y preservaron cepas bacterianas a partir de suelo, hojas y frutos de jitomate. Se caracterizaron con pruebas fenotípicas bioquímicas y utilizando el sistema de galerías API20 E y API20 NE de Biomerieux, algunas cepas se han identificado por secuencias de 16S rDNA. Se aislaron 69 cepas bacterianas, con 17 especies diferentes. Ciertas especies están reportadas como patógenas en el humano. Burkholderia cepacia, es un patógeno oportunista en enfermos de fibrosis quística, Pasteurella pneumotropica ocasionalmente puede producir absceso epidural espinal. Chryseobacterium indologenes es el más frecuente aislado generalmente en inmunocomprometidos. Pocos casos de Brevundimonas bacteriemia se han reportado con neumonía, endocarditis infecciosa y peritonitis espontáneas siendo el más común en focos de infección (INEP, 2000; Fernández et al. 2011; Sakurada, 2008; Lee, et al, 2011). A Myroides spp. se le ha asociado como causante de infecciones nosocomiales. Se publicó bacteriemia producida por P. phenylpiruvicus en un paciente cirrótico, como consecuencia de la ingestión de almeja. Stenotrophomonas maltophilia ha producido meningitis, su importancia radica en la patología nosocomial, debido fundamentalmente a su alta resistencia a los antimicrobianos (Mammeri et al, 2002; Leung et al. 2006; Chrystal et al., 2006). Aunque la presencia de las bacterias antes mencionadas presentes en el jitomate no implica una infección directa en los humanos, se desconoce si eventualmente podría existir algún mecanismo que suponga riesgo potencial para quienes poseen condiciones de inmunosupresión, por lo que se requiere de estudios más precisos para evidenciar una relación de estas bacterias como posibles agentes oportunistas, como se han referido algunos reportes.

Evaluación de 5 tratamientos al suelo, alternativos al bromuro de metilo, en un cultivo de tomate

1 Sepúlveda–Chavera, G.; Salvatierra–Martínez, R.; Rodríguez–Molina, M. 1Núcleo de Patología Vegetal, Centro de Agricultura y Biodiversidad, Facultad de Cs. Agronómicas, Universidad de Tarapacá, Arica, Chile. E-Mail: gsepulve@uta.cl

El bromuro de metilo es el fumigante de suelos más efectivo utilizado para el cultivo de tomates, usándose intensivamente en Azapa desde 1990. Sin embargo, debido a restricciones ambientales y a los lineamientos emanados del Protocolo de Montreal (1985) es necesario evaluar productos que lo reemplacen. El objetivo de este estudio fue evaluar el efecto de 5 tratamientos al suelo, alternativos al bromuro de metilo, en la población de nemátodos fitoparásitos en suelo. Las evaluaciones se hicieron entre marzo y agosto de 2012, en un cultivo al aire libre, en el campo experimental de la U. Tarapacá, Arica, Chile. El diseño experimental fue cuadro latino 6x6 y los tratamientos fueron: Anacelhone (1,3 dicloropropeno 55,4 %+ cloropicrina 37,2 %) 60 cc∙m–2 ; Metam sodio (80 y 120 cc∙m–2 ); un portainjerto (Maxifort®); el producto biológico Bafex® (Bacillus subtilis); y un testigo sin aplicación. El suelo estaba infectado con nematodos fitoparásitos del género Meloidogyne y el hongo fitopatógeno Fusarium oxysporum. Se evaluó Índices de agallamiento de raíces, recuento de población de nematodos y UFC antes y después del tratamiento y producción de tomates. Metam sodio (Nemasol®) y Anacelone® fueron los más efectivos (p>0,05) en la reducción de la población de Meloidogyne incognita y F. oxysporum. Los otros tratamientos no redujeron la población y, el uso del portainjerto Maxifort® incremento la población de Meloidogyne en 32 veces. La mejor producción de fruta se logró con Metam sodio.

Diversidad genética de aislados chilenos de Grapevine fanleaf virus (GFLV), Grapevine leafroll-associated virus-2 (GLRaV-2) y Grapevine rupestris stem pitting-associated virus (GRSPaV)

Zamorano, A.; González, X.; Fiore, N. Facultad de Ciencias Agronómicas, Universidad de Chile, Santiago, Chile E-Mail: agezac@u.uchile.cl

La vid (Vitis vinifera L.) es el principal cultivo en Chile, con 187.901 hectáreas plantadas destinadas al consumo fresco y para la producción de vino y pisco. Además de ser afectada por hongos, bacterias y fitoplasmas, la vid es hospedero de virus y viroides, los cuales son transmitidos principalmente a través de la multiplicación vegetativa de plantas infectadas. En estudios realizados en Chile, se han detectado numerosos virus que afectan a la vid, entre los cuales se encuentran Grapevine fanleaf virus (GFLV), Grapevine leafroll-associated virus 2 (GLRaV-2) y Grapevine rupestris stem pitting-associated virus (GRSPaV); muy importantes por su agresividad y alta variabilidad genética. A través del análisis bioinformático, algunos aislados chilenos pertenecientes a estas especies virales se utilizaron para la comparación de secuencias completas de la región codificante del RNA2 de GFLV, del gen de la proteína de cápside de GLRaV-2 y la secuencia parcial del gen de la subunidad helicasa del complejo RNApol de GRSPaV, identificadas como regiones genómicas ideales para este tipo de estudio. La amplificación se realizó por RTPCR con partidores diseñados específicamente para cada una de las regiones descritas. Los resultados mostraron la agrupación de algunos aislados chilenos de GFLV y GLRaV-2 en dos nuevos grupos filogenéticos, diferentes a los previamente descritos. Un menor número de aislados de GFLV y GLRaV-2 y todos los aislados de GRSPaV no mostraron diferencias filogenéticas con los grupos conocidos; la información generada indicaría la existencia de factores geográficos que condicionan la variabilidad genética de GFLV y GLRaV-2. Estos resultados muestran que, para la optimización de los métodos de detección por amplificación génica, es oportuno conocer las secuencias de las regiones del genoma implicadas en la detección de rutina de los aislados virales locales, para averiguar eventuales variaciones que podrían causar resultados falsos negativos. Proyecto CSIC/U. DE CHILE 04/11-12.

Asociación de especies vegetales circundantes a murtilla (Ugni molinae Turcz.) como posibles reservorios naturales de fitoplasmas causales de la enfermedad escoba de bruja

1Miranda, P.; 1 Andrade, N.; 1 Arismendi, N.; 2Moya-Elizondo, E.; 1Riegel, R. 1 Facultad de Ciencias Agrarias, Universidad Austral de Chile, Campus Isla Teja, Valdivia, Chile 2 Facultad de Agronomía, Universidad de Concepción, Campus Chillán, Chillán, Chile E-Mail: pablo.miranda.oliver@gmail.com

En murtilla (Ugni molinae Turcz.) se ha demostrado que la enfermedad “escoba de bruja” es producida por fitoplasmas. La dispersión de la enfermedad se asocia a insectos vectores, tales como Amplicephalus curtulus Linnavuori & De Long (Hemíptera: Cicadellidae). Sin embargo, tanto reportes nacionales como internacionales, sugieren que especies vegetales consideradas malezas pueden actuar como reservorios naturales de enfermedades asociadas a fitoplasmas. Con tales antecedentes, el objetivo de este estudio fue evaluar si las malezas Lotus uliginosus L., Hypochaeris radicata L., Plantago lanceolata L. y Agrostis capillaris L., circundantes en mayor frecuencia a plantas de murtilla, son reservorio natural de fitoplasmas responsables de la enfermedad “escoba de bruja”. Para ello se tomaron muestras de tales malezas desde murtales enfermos en los períodos estivales de 2011 y 2012 en tres localidades cercanas a Valdivia y Puerto Saavedra. En paralelo, se realizaron dos experimentos de transmisión de fitoplasmas hacia las cuatro malezas en estudio bajo condiciones controladas de crecimiento. El primero, agrupó en jaulas entomológicas a cada especie vegetal con adultos de A. curtulus provenientes de murtales enfermos junto a ballicas (Lolium multiflorum L.) como control de transmisión, durante 30 días. El segundo experimento, similar al anterior, tuvo además la incorporación de plantas de murtilla con síntomas de “escoba de bruja” e insectos en estado ninfal, libres de la infección. El análisis de muestras estivales mediante PCR-anidada (partidores F2n/R2), no detectó presencia de fitoplasmas. No obstante, el análisis de otras malezas cercanas, detectó la presencia del “Ca. Fitoplasma ulmi” (16SrV-A) en pasto dulce (Holcus lanatus L.). Los experimentos de transmisión no arrojaron resultados positivos, debido a la baja sobrevivencia de los insectos vectores. Los resultados obtenidos demuestran que las cuatro malezas estudiadas no evidencian la presencia de fitoplasmas, por lo que no actuarían como reservorios alternativos relevantes de la enfermedad. Fuente financiamiento: Beca Magister Nacional CONICYT; Proyecto DID S-2011-42.

Detección simultánea de CTV, CEVd y HSVd a través de bio-amplificación y RT-PCR

Camps, R.; Castro, M.; Besoain, X. Pontificia Universidad Católica de Valparaíso, Facultad de Agronomía. Quillota, Chile E-Mail: rocio.camps@ucv.cl

El Virus de tristeza de los cítricos (CTV), el viroide de la exocortis (CEVd) y el viroide del enanismo del lúpulo (HSVd) (previamente conocido como viroide de la Cachexia (CCaVd)), son patógenos que afectan a plantas de cítricos en Chile. El uso de un método de diagnóstico rápido junto con la limpieza eficaz de portainjertos infectados, es una potente herramienta preventiva en el control de las enfermedades virales. El objetivo de este trabajo fue detectar de forma simultánea CTV, CEVd y HSVd con el método de bio-amplificación en Cidro Arizona 861-S combinado con dos temperaturas de incubación y RT-PCR (Transcripción reversa-PCR) en dos pasos. Se inocularon plantas de Cidro Arizona 861-S de forma simultánea con los tres patógenos, y también de forma individual con cada uno de ellos. A partir de los 4 meses de incubación, a dos diferentes temperaturas, las plantas inoculadas de forma individual mostraron síntomas asociados con estos patógenos, aquellas inoculadas de forma simultánea presentaron síntomas asociados a los tres patógenos inoculados, los testigos inoculados con plantas libres de virus y viroides no presentaron síntomas asociados a las enfermedades. Posteriormente fueron corroborados mediante RT-PCR en dos pasos, donde se estandarizó una metodología para los tres patógenos, la RT fue realizada por separado para virus y viroides y el PCR se llevó a cabo de forma múltiple para los tres patógenos. Este método podría ser utilizado de forma alternativa a los actualmente en uso para la detección de CTV, CEVd y HSVd, sin embargo su eficacia debe ser evaluada usando diferentes aislados de estos patógenos. Fuente de Financiamiento: VRIEA-PUCV. Proyecto DI 037.412/2012.

Paratanus exitiosus Beamer es vector del fitoplasma 16SrIII-J (grupo X-disease)

Longone, V.; Zamorano, A.; González, X.; Pino A.M.; Fiore, N. Facultad de Ciencias Agronómicas, Universidad de Chile, Santiago, Chile E-Mail: nfiore@uchile.cl

Durante el año 2011, desde enero hasta mayo (excepto febrero), se realizó una prospección de insectos Hemípteros auquenorrinco en viñedos infectados por fitoplasmas; dos ubicados en la Región Metropolitana (Alto Jahuel y Pirque) y uno en la de Valparaíso (Casablanca). Se determinó que la especie más abundante encontrada corresponde al cicadélido Paratanus exitiosus Beamer. Desde septiembre de 2011 a mayo 2012, mensualmente, en los mismos tres viñedos, se capturaron individuos adultos de P. exitiosus para realizar las pruebas de transmisión en jaulas entomológicas utilizando plantas de vinca (Catharanthus roseus L.) y de vid cv. Cabernet Sauvignon, obtenidas desde semillas y libres de fitoplasmas. Las capturas se realizaron con redes entomológicas. Desde las plantas y los insectos de transmisión, se extrajo el DNA para la detección con PCR anidada, utilizando partidores que amplifican regiones del genoma de fitoplasmas correspondientes a los genes tuf y 16S rDNA. La identificación de los fitoplasmas se realizó mediante análisis de secuencia y RFLP in silico. Individuos adultos de P. exitiosus han transmitido el fitoplasma 16SrIII-J (X-disease group) a plantas de vinca, que han manifestado virescencia, filodia, amarilleces en hojas y proliferación de yemas adventicias (“escoba de bruja”). También, se demostró que P. exitiosus transmitió el mismo fitoplasma a plantas de vid, las que presentaron entrenudos cortos con hojas deformadas y enrolladas hacia el envés. Los resultados del presente trabajo indican, por primera vez, que P. extiosus es vector del fitoplasma perteneciente al subgrupo ribosomal 16SrIII-J. Proyecto FONDECYT N°11090180.

Virus que infectan a la higuera (Ficus carica L.) en Chile

Ubidia, P.; Zamorano, A.; Franck, N.; Fiore, N. Facultad de Ciencias Agronómicas, Universidad de Chile, Santiago, Chile E-Mail: pcubidia@gmail.com

La enfermedad denominada mosaico de la higuera está ampliamente distribuida en el mundo y muchas informaciones se han generado sobretodo en los países de la cuenca del Mediterráneo. En Chile se observa la presencia de síntomas en higuera, pero no se dispone de informaciones acerca de la identidad de los virus asociados al cultivo. A través de este trabajo se realizó una prospección visitando y colectando material vegetal en los principales huertos comerciales y viveros de las regiones de Coquimbo, Valparaíso, Libertador Bernardo O´Higgins y Metropolitana. Se colectaron 120 muestras que se analizaron mediante la técnica de RT-PCR para la detección de Fig leaf mottle–associated virus 1 y 2 (FLMaV-1 y 2), Fig mosaic virus (FMV), Fig mild mottle– associated virus (FMMaV), Fig fleck–associated virus (FFkaV), Arkansas fig closterovirus 1 y 2 (AFCV-1 y 2), Fig badnavirus 1 (FBV-1), Fig cryptic virus (FCV), Fig latent virus 1 (FLV-1). Las variedades más cultivadas son “Black Mission” (higo negro) y “Kadota” (higo blanco). El virus encontrado con mayor frecuencia fue el FBV-1 (84,0%), seguido por FMV (69,8%), FLMaV-1 (62,2%), FMMaV (21,0%), FLMaV-2 (10,9%), AFCV-2 (7,6%) y FFkaV (3,4%). En las 120 muestras analizadas no se detectaron los virus FCV, FLV-1 y AFCV-1; solo en el 3,3% de muestras se obtuvo un resultado negativo para todos los virus buscados. Los productos de amplificación obtenidos se clonaron y secuenciaron y el análisis bioinformático confirmó la detección obtenida por RT-PCR. Se detectaron infecciones virales simples (20,0%), dobles (20,8%), triples (29,2%), cuádruples (25,8%) o quíntuples (0,8%). Esta representa la primera detección de FBV-1, FMV, FLMaV-1, FMMaV, FLMaV-2, AFCV-2 y FFkaV en higuera en Chile. Información que indica la necesidad de implementar a la brevedad un programa de saneamiento del cultivo.

Herramienta Grin-Global para el manejo curatorial de los Bancos de Germoplasma

Díaz, R., León-Lobos, P., Barra, L., Matus I. Programa de Recursos Genéticos, Instituto de Investigaciones Agropecuarias, Vicuña, Chile E-Mail: rodrigo.diaz@inia.cl

Los bancos de germoplasma, como unidades a cargo de la conservación de recursos fitogéneticos, requieren de un sistema informático que permita almacenar, sistematizar y poner a disposición la información de las colecciones de germoplasma, a los potenciales usuarios. Además, este sistema permite apoyar efectivamente el manejo curatorial de los bancos de germoplasma. INIA ha adoptado la herramienta Grin-Global (http://www.inia.cl/gringlobal/) con el objetivo de administrar sus colecciones y optimizar el manejo curatorial de sus bancos de germoplasma. Grin-Global es un sistema de documentación integrado que incluye bases de datos y herramientas de manejo de información. En una primera etapa, se ha implementado para su funcionamiento la herramienta del curador y de búsqueda. Este sistema de documentación está estructurado a partir de bases de datos locales en cada banco, las que convergen en un servidor global accesible en línea. Actualmente, se han ingresado a Grin-Global información de 8.596 accesiones correspondientes a cultivos como maíz, poroto, lenteja, arveja, quínoa, zapallo, trigo, entre otros y, también de especies nativas. Grin-Global es una herramienta adaptable a los requerimientos institucionales lo que ha permitido el manejo y organización flexible de los catálogos de germoplasma de Chile, ayudando a ordenar y sistematizar colecciones, facilitando así la gestión de los bancos de germoplasma de INIA. También, permite realizar las consultas en línea y con esto posibilitar el acceso informado y normado a los recursos genéticos conservados. Además facilita la conectividad y manejo desde cualquier lugar con acceso remoto permitiendo a los curadores hacer una gestión más eficiente de los bancos.

Evaluación in vitro de activos de fungicidas en el control de Monilinia fructicola

1 Sepúlveda, P.; 2 Álvarez, M.; 1Rebufel, P.; 1 Barrales, P. 1 Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación La Platina, Santiago, Chile 2 Asesor privado, Santiago, Chile. E-Mail: psepulve@inia.cl

El hongo Monilinia fructicola es un patógeno cuarentenario para Chile, que se caracteriza por atacar preferentemente a los frutos de carozos tanto a nivel de huerto como almacenaje y comercialización. De acuerdo a información generada por SAG el hongo se encuentra afectando huertos frutales del género Prunus en las Regiones Metropolitana, O’Higgins y Maule. Con el objetivo de evaluar la respuesta de diferentes activos de fungicidas, tanto solos como en mezclas, en la inhibición del crecimiento del micelio del hongo in vitro y determinar su valor EC50, se estableció un ensayo donde se evaluaron los activos boscalid, clorotalonil, , fenbuconazole, fenhexamid, fluazinam, fludioxonil, iprodione, metil-tiofanato, miclobutanilo, piraclostrobin, pyrimetanil, propiconazole, tebuconazole, ciprodinil / propiconazole, cyprodinil / fludioxonil, iprodione / propiconazol, tebuconazole / tryfloxistrobin y tryfloxistrobin / pyrimetanil. Los fungicidas se evaluaron a 0,0025; 0,025; 0,25; y 2,5 ppm incorporados a placas con APD, con tres repeticiones. El efecto de inhibición fue determinado en comparación con el crecimiento del hongo en placas testigo sin activo a los 8 días a temperatura de 20-22°C. El EC50 se estableció mediante regresión lineal entre la variable concentración del fungicida y su correspondiente porcentaje de inhibición. Los valores de EC 50 para los activos fueron: boscalid 0,15 ppm, clorotalonil 0,05 ppm, fenbuconazole 0,02 ppm, fenhexamid 0,01 ppm, fluazinam 0,07 ppm, fludioxonil 0,02 ppm, iprodione 0,05 ppm, metil-tiofanato 0,02 ppm, miclobutanilo 0,03 ppm, piraclostrobin 0,24 ppm, pyrimetanil 0,07 ppm, propiconazole 0,03 ppm, tebuconazole 0,03 ppm, ciprodinil/propiconazole 0,15 ppm, cyprodinil/fludioxonil 0,01 ppm, iprodione / propiconazol 0,07 ppm, tebuconazole / tryfloxistrobin 0,01 ppm y tryfloxistrobin / pyrimetanil 0,001 ppm. Como conclusión se puede señalar que todos los activos, tanto solos como combinados tuvieron efecto en inhibir del crecimiento del hongo.

Esclerotiniosis (Sclerotinia sclerotiorum (Lib.) de Bary) en kiwi. Avances en epidemiología e inhibición del hongo in vitro

1 Sepúlveda, P.; 2 Álvarez, M.; 1Rebufel, P. 1 Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación La Platina, Santiago, Chile 2 Asesor Copefrut S.A., Santiago E-Mail: psepulve@inia.cl

La Esclerotiniosis causada por Sclerotinia sclerotiorum (Lib.) de Bary fue descrita en Chile en 1993 afectando a kiwis (Actinidia deliciosa) causando pérdidas por pudriciones de frutos en huertos de la provincia de Curicó incluyendo pudriciones en almacenaje en frío. En el verano de la temporada 2012/13 la Esclerotiniosis reapareció causando daños de frutos y flores en varios huertos de la Región del Maule. El hongo se aisló de frutos con pudrición, en APD y su identificación se realizó de acuerdo a las estructuras típicas de desarrollo (color, crecimiento y morfología de micelio y esclerocios). La pudrición de frutos se encontraba asociada con presencia de flores marchitas adheridas a su superficie. El presente trabajo postula ésta asociación como factor principal en la epidemiología de la enfermedad en donde la infección de frutos se produciría a través de restos florales como inóculo primario. Con el propósito de establecer el efecto de fungicidas en la reducción del crecimiento del micelio del hongo in vitro, se probaron los activos propiconazole, iprodione, boscalid, fenhexamida y tebuconazole en a concentraciones 0; 0,05; 0,5; 7; y 10 ppm incorporados a placas con APD. El efecto se determinó comparando el crecimiento del hongo en placas con y sin activos. El respectivo EC50 se estableció mediante regresión lineal entre la variable concentración del fungicida y su correspondiente % de inhibición. Los resultados señalaron que todos los activos, excepto boscalid, tuvieron efecto en inhibir del crecimiento del hongo a 7 y 10 ppm con valores superiores a 83%. Los valores de EC50 variaron de 1,0 a 1,6 ppm para todos los fungicidas excepto boscalid que fue de 10,7 ppm.

Efecto de atmósfera controlada en la incidencia de pudriciones de postcosecha en palta var. Hass

Soto-Alvear, S.; Robledo, P.; Defilippi, B. Unidad de Postcosecha, Instituto de Investigaciones Agropecuarias. Centro Regional de Investigación La Platina E-Mail: sylvana.soto@inia.cl

El aumento de plantaciones de paltas en Chile con el consiguiente aumento en la producción, hace necesario la búsqueda de nuevos mercados que requieren un mayor tiempo para llegar a destino, lo que favorece el desarrollo de pudriciones, como Colletotrichum gloeosporioides u otros asociados a la zona peduncular. El objetivo fue evaluar la incidencia de pudriciones de postcosecha en paltas var. Hass provenientes de 12 huertos, y sometidas a diferentes condiciones de almacenamiento. Durante la temporada 2012-2013 se colectó fruta de cada huerto, y parte de ella se almacenó en aire regular (T1), y otro grupo se almacenó por 30 días en atmósfera controlada (4 %O2 y 6 %CO2) para posteriormente continuar su almacenamiento en aire regular (T2). Ambos tratamientos fueron almacenados por 40 y 55 días a 5°C, para posteriormente realizar un período de simulación de venta a 20°C, hasta madurez de consumo (firmeza <2Lb-f). En paltas de 40 días de almacenamiento se observó una baja incidencia de pudriciones con valores menores a 5,5% sin mostrar diferencias entre tratamientos, con excepción de un huerto que presentó una incidencia de 5 y 22% en T1 y T2, respectivamente. Esto se debería a que T1 permaneció en promedio 1 días a 20°C, mientras que T2 estuvo 4 días. En general, en la evaluación de los 55 días, se observó un aumento en la incidencia de enfermedades en la mayoría de los huertos, presentando valores entre 0 y 21% en T1 y entre 0 y 37% en T2. Las pudriciones de postcosecha no ha sido un factor limitante en las exportaciones, pero un mayor tiempo de almacenamiento puede significar una mayor incidencia, sobre todo de huertos sin manejo de fuentes de inóculo. Por lo que sería importante establecer manejos culturales y posiblemente aplicaciones de fungicidas estratégicos para poder controlar enfermedades de postcosecha. Financiamiento Proyecto Innova 11CEII-9568.

Tolerancia y capacidad antagónica de Trichoderma spp nativos en ambientes salinobóricos

Salvatierra-Martínez, R.; Sepúlveda-Chavera, G; Rodríguez-Molina, M. Núcleo de patología vegetal, Universidad de Tarapacá. Arica, Chile E–Mail: gsepulve@uta.cl

En los valles de Lluta y Azapa (Region Arica y Parinacota, Chile), la agricultura está estrechamente relacionada con la salinidad y altos niveles de boro, donde cepas comerciales de Trichoderma spp exógenos muestran resultados erráticos. Se evaluó la tolerancia y capacidad biocontroladora de 10 cepas nativas de Trichoderma y un bioformulado comercial de cepas exógenas en condiciones salino-bóricas. En pruebas de tolerancia in vitro los tratamientos fueron APD (Agar Papa Dextrosa) y APD enmendado con 8, 15 y 20 g L-1 de NaCl, y las tres dosis de NaCl + 15 mg·L-1 Bo. Se realizaron cultivos duales in vitro de Trichoderma spp vs F. oxysporum (Fox) en en APD con 8 g L-1 de NaCl y sin enmendar. Los datos se analizaron con el test de Kruskall – Wallis y ANDEVA, separando medias con la prueba de Tukey y la prueba LSD de Fisher (p ≤ 0.05); la prueba de t (p ≤ 0.05) se usó para los datos de crecimiento de Fox en APD y ADP enmendado con 8 g·L-1 NaCl. Se midió concentración de cationes en micelio de las tres cepas más tolerantes. Las cepas nativas fueron tolerantes a 20 g L-1 de NaCl, mayores niveles de Na+ en el micelio se asociaron con tolerancia a la salinidad. Las soluciones salinas con Bo redujeron en mayor medida el crecimiento y esporulación. Se observó significativo mayor crecimiento de Fox en solución salina (p ≤ 0.05). Sesenta plantas de tomate de 15 días fueron sumergidas 5 min en una solución de agua con 1 x 106 conidias·ml-1 de Fox antes de trasplante y regadas con agua con 4 g L-1 NaCl + 1 x 106 conidias·ml-1 de Trichoderma, de estas, 15 con Trichoderma nativo y 15 con las cepas exógenas las tratadas con las cepas nativas tuvieron el mayor porcentaje de sobrevivencia.

Efectividad de isofetamida en el control de Botrytis cinerea en la vid

Piqueras, P.; Torres, R.; Latorre, B.A. Pontificia Universidad Católica de Chile, Facultad de Agronomía e Ingeniería Forestal, Santiago, Chile E-Mail: cmpiqueras@uc.cl

La pudrición gris (B. cinerea) limita la producción y calidad de la vid (Vitis vinifera) en Chile. El control se logra integrando estrategias culturales con tratamientos fungicidas. Se estudió la efectividad de isofetamida (IKF-5411 40 SC) en relación a fenhexamida (Teldor 50 WP) contra B. cinerea en vid ‘Chardonnay’, ‘Flame Seedless’ y ‘Thompson Seedless’ en Chile. Los tratamientos: isofetamida (33,2 g/100L), fenhexamida (40,0 g/100L) más un testigo sin tratar, se aplicaron en floración y pre-cosecha(1200 L/ha). La efectividad se determinó en floración y en cosecha. En floración, se recolectaron 100 flores/tratamiento, una vez secas las mismas (2 a 3 h postaplicación). Estas se incubaron en APD por 7 días a 20ºC antes de determinar la presencia de B. cinerea. La prevalencia y severidad de la pudrición gris se evaluó en campo en 25 racimos y en ~500 g de bayas/unidad experimental. Estas se inocularon en laboratorio con una baya infectada, se incubaron por 7 días a 20ºC y se determinó la proporción de bayas con pudrición gris. En flores, hubo 24 a 31% de contaminación con B. cinerea, esto se redujo a 9 a 13,5% con isofetamida y 4 a 7,3% con fenhexamida. En precosecha, hubo 4 a 26 % de prevalencia de pudrición gris en los testigos, con una severidad entre 0,16 y 7,7 bayas enfermas/100 racimos. Isofetamida redujo la prevalencia en ‘Flame Seedless’ (6%) y ‘Thompson Seedless’ (8%) con una severidad entre 0,7 y 1,4 bayas enfermas/100 racimos. Resultados similares se obtuvieron en condiciones de postcosecha. En conclusión, isofetamida (40 g i.a./100L) presenta buena efectividad preventiva contra B. cinerea en vid. No hubo evidencia de fitotoxicidad en bayas o follaje.

Aumento de la competitividad de la uva de mesa chilena a través del establecimiento de una plataforma on line de sensibilidad a botryticidas

Esterio, M.; Araneda, M.J.; Copier C.; Auger, J. Laboratorio de Fitopatología Frutal y Molecular, Depto. de Sanidad Vegetal, Facultad de Ciencias Agronómicas, Universidad de Chile, Santiago, Chile E-Mail: mesterio@uchile.cl

El control de Botrytis en uva de mesa se basa en el uso de fungicidas aplicados en los periodos críticos de infección. Botrytis por su biología es considerado un patógeno de alto riesgo de generar resistencia a fungicidas (alta variabilidad genética y fenotípica que condiciona una respuesta de agresividad y de sensibilidad fungicida diferencial). Con el fin de optimizar el uso de los fungicidas botryticidas base de los programas de control en las principales zonas productoras de uva de mesa en Chile, InnovaChile de CORFO ha apoyado un proyecto cuyo principal objetivo es evaluar los cambios de sensibilidad de poblaciones de Botrytis spp. a los botryticidas durante las temporadas 2011-2012 y 2012-2013, en 15 predios de tres regiones (Valparaíso (V), Metropolitana (RM) y del Libertador Bernardo O’Higgins, (VI)) mediante monitoreos efectuados en floración y cosecha, y en base a los resultados obtenidos, el diseño de los programas de control más adecuados. La determinación de sensibilidad consideró el uso de técnicas tradicionales (crecimiento miceliar, germinación conidial y elongación del tubo germinativo) en medios diferenciales según fungicida, determinándose valores EC50, y calculándose los siguientes parámetros: Índice y Frecuencia de Resistencia y Categorización del nivel de resistencia de la población analizada. Los resultados obtenidos en éstas dos temporadas permiten señalar que las poblaciones de Botrytis reaccionan rápidamente frente al manejo fungicida al cual sean sometidas, detectándose recuperación de sensibilidad a fenhexamid en algunos predios de la región Metropolitana (EC50< 0,1ppm) y mantención de alta resistencia en otros, particularmente en algunos predios de la V y VI regiones (EC50>3ppm); mantención de sensibilidad a cyprodinil & fludioxonil ( (EC50<0,1 ppm); incremento de valores EC50 a boscalid (EC50>2ppm) y a tebuconazole (EC50>1ppm), y niveles de resistencia leve a moderada a iprodione (EC50>1 ppm) en las tres regiones. Además de detectar cambios en la frecuencia de resistencias específicas, se visualizaron disminuciones en la frecuencia de resistencias del tipo multidroga (MDR), particularmente, en las regiones Metropolitana y del Libertador Bernardo O´Higgins. Proyecto U. de Chile – INNOVACHILE de CORFO (Código INNOVA: 11BPC9947).

Caracterización genética y fenotípica de aislados chilenos de Botrytis spp. de diferente grado de sensibilidad a boscalid

Román, A.; Auger, J.; Esterio, M. Laboratorio de Fitopatología Frutal y Molecular, Depto. de Sanidad Vegetal, Facultad de Ciencias Agronómicas, Universidad de Chile, Santiago, Chile E-Mail: mesterio@uchile.cl

Botrytis spp., agente causal de la pudrición gris de la vid, causa importantes pérdidas en la uva de mesa en Chile. En el control químico de este patógeno se utiliza entre otras moléculas a boscalid, carboxamida que actúa inhibiendo la enzima succinato deshidrogenasa. En aislados de Botrytis, provenientes de cultivos sometidos a un uso intensivo de boscalid, se ha demostrado la asociación entre la pérdida de sensibilidad al fungicida con mutaciones en el gen sdhB, en donde se han identificado las mutaciones P225F/L/T y N230I asociadas a aislados resistentes y en mayor frecuencia las mutaciones H272R/Y/L asociadas a aislados resistentes y moderadamente resistentes. El objetivo de este estudio, fue determinar la presencia de mutaciones en el gen sdhB en aislados chilenos de Botrytis spp. con distinto nivel de sensibilidad a boscalid. Con este propósito se caracterizaron genética y fenotípicamente 32 aislados monoconidiales. Para la caracterización fenotípica se verificó el nivel de sensibilidad a boscalid, determinándose según valores EC50, 4 categorías de sensibilidad: sensibles (S), levemente resistentes (LR), moderadamente resistentes (MR) y resistentes (R). Además aislados resistentes y sensibles de Botrytis spp. fueron comparados según: crecimiento miceliar, producción de esporas, sensibilidad osmótica, producción de esclerocios y virulencia. La detección de mutaciones en el gen sdhB se realizó mediante la técnica PCR-PIRA con los partidores H272Y/R-fw y H272-rev, cuyos productos fueron digeridos con enzimas de restricción como: EcoRV y HhaI respectivamente. Los aislados analizados de Botrytis spp., presentaron valores EC50 fluctuantes entre 0,13µg.ml-1 y 1,1*109 µg.ml- 1 . Con la utilización de la técnica PCR-PIRA se detectaron las mutaciones H272Y y H272R en aislados R y en algunos MR en el gen sdhB, indicando que ninguna de las dos mutaciones detectadas serían específicas para un determinado nivel de resistencia a boscalid, a su vez estas mutaciones son frecuentes en la aislados de Botrytis en Chile.

Estrategia de control integrado de oídio en vides: consecuencias para la sustentabilidad del viñedo

1 Valdés-Gómez, H.; 1 Araya-Alman, M.; 1 Verdugo-Vásquez, N.; 1Mallea, C.; 2 Lavandero, B.; 1 Pañitrur-De la Fuente, C.; 3 Lolas-Caneo, M.; 1 Acevedo-Opazo, C. 1CITRA-Universidad de Talca, Facultad de Ciencias Agrarias, Talca 2Universidad de Talca, Instituto de Biología y Biotecnología Vegetal, Talca 3Universidad de Talca, Facultad de Ciencias Agrarias, Laboratorio de Patología Frutal, Talca E-Mail: hevaldes@utalca.cl

Los programas fitosanitarios calendarizados para el control de oídio en viñedos pueden afectar negativamente la sustentabilidad del sistema vitícola por la excesiva utilización de pesticidas. Como solución, se implementó una estrategia de control integrado de oídio la cual se basa en el monitoreo en terreno de los síntomas causados por el patógeno y de la fenología del cultivo. El estudio se llevó a cabo durante cuatro temporadas (2009-2013) en la Estación Experimental de la Universidad de Talca (35°22.2’ S, 71°35.39’ O, 121 m.s.n.m.), en dos cuarteles de vid (Cabernet Sauvignon y Chardonnay). En estos cuarteles se compararon tres tratamientos: un manejo reducido en fungicidas según la experiencia del viticultor, principalmente usando azufre (T1), un manejo integrado utilizando un monitoreo en terreno y sin azufre (T2) y un testigo sin aplicaciones (T0). Cada tratamiento se repitió cuatro veces en un diseño de bloques al azar. Adicionalmente una encuesta a nueve viñedos comerciales de la zona permitió conocer el manejo tradicional calendarizado de estos (MTC). Los resultados mostraron una severidad del daño por oídio en T1 y T2 inferior a 5% en las 4 temporadas, considerado como adecuado para un manejo comercial. Diversos indicadores de impacto ambiental como el índice de frecuencia de tratamientos a dosis completa (IFT), la huella de carbono (HC) y un índice indicativo de la población de huevos de falsa arañita roja de la vid (IAR) mostraron que la estrategia que utiliza el monitoreo en terreno fue más sustentable que los otros tratamientos evaluados. Así T2 presentó una reducción de más del 50% y 75% con respecto a T1 y a MTC en el índice IFT. Además T2 presentó una HC 3 y 4 veces inferior comparado a T1 y MTC, respectivamente. Finalmente el índice IAR fue 10 veces superior en el manejo de T1 comparado con T2.

Etiología de la necrosis vascular de la madera de la vid en Chile

Díaz, G. A.; Latorre, B. A. Facultad de Agronomía e Ingeniería Forestal, Pontificia Universidad Católica de Chile, Santiago, Chile E-Mail: gadiaz3@uc.cl

Las enfermedades de la madera de la vid (Vitis vinifera) se reconocen como un importante y creciente problema en el mundo. Este estudio tuvo por objetivo determinar la etiología de la necrosis vascular de la madera. Se analizaron plantas de viveros y viñedos jóvenes y adultos de vides las que se obtuvieron en 67 viñedos localizados a lo largo de 1500 km de norte (Copiapó) a sur (Los Ángeles) de Chile. Los resultados demostraron la presencia de Phaeomoniella chlamydospora en un 94% de las plantas afectada por necrosis vascular de la madera. La identificación morfológica se corroboró mediante análisis molecular de los genes ITS y β-tubulina. Los análisis concatenados de secuencias de los genes ITS y β-tubulina agruparon a los aislados chilenos con aislados de referencia de Sudáfrica y EUA, mientras que los aislados españoles formaron un grupo diferente. Las conidias de los aislados chilenos germinaron entre 5 y 35ºC con una temperatura óptima de crecimiento entre 25 y 30ºC, dependiendo del aislado. Los aislados de Pa. chlamydospora fueron patogénicos en plántulas axénicas de vid y en troncos (2 años de edad), pitones y brotes de vides de vides jóvenes, desarrollando necrosis vascular café oscuro a negro. Pa. chlamydospora se reaisló en la totalidad de los órganos inoculados. En conclusión, Pa. chlamydospora es el agente causal de la necrosis vascular de la madera observada tanto en viveros como en viñedos de vid en Chile.

Respuesta de la vid a la concentración de inóculo de Phaeomoniella chlamydospora, causante de la necrosis vascular

Díaz, G.A.; Latorre, B.A. Facultad de Agronomía e Ingeniería Forestal, Pontificia Universidad Católica de Chile, Santiago, Chile E-Mail: gadiaz3@uc.cl

La necrosis vascular de la madera en vid (Vitis vinifera L.) ocurre frecuentemente en plantas a nivel de viveros y viñedos comerciales en Chile. Se caracteriza por la presencia de estrías necróticas, oscuras, del tejido vascular, posibles de observar en cortes longitudinales. El presente estudio tuvo por objetivo determinar el efecto de la concentración de inóculo de Phaeomoniella chlamydospora Crous & W. Gams sobre la inducción de necrosis vascular de la madera de la vid. Para este propósito se inocularon plántulas axénicas (n=8), estacas leñosas (n=8) y pitones (n=20) de vides ‘Cabernet Sauvignon’ con 0, 102 , 105 y 107 conidias/mL de Pa. chlamydospora. Las plántulas axénicas se inocularon con 10 µL de cada concentración de conidias. Las estacas leñosas y los pitones se inocularon con 20 µL de cada concentración, incluyendo el tratamiento con 20 µL de agua como testigo. Después de 28 días pos-inoculación (dpi) a 20°C, las plántulas axénicas presentaron clorosis y enrojecimiento foliar junto con entrenudos cortos y menor crecimiento en función de la concentración del inóculo. Las estacas leñosas (45 dpi a 25°C) y los pitones (200 dpi en el viñedo) desarrollaron estrías vasculares de 6,5 a 20,8 mm y 30,6 a 68,8 mm de longitud, respectivamente, en directa respuesta al incremento en la concentración de inóculo. Las inoculaciones en estacas leñosas provocaron enrojecimiento foliar y redujeron significativamente (p<0,05) el desarrollo radical y de los brotes. Sin excepción, los testigos sin inocular se mantuvieron asintomáticos. En conclusión, la severidad de la necrosis vascular de la vid ocurrió en directa respuesta a la concentración de inóculo de Pa. chlamydospora. Bajo las condiciones de este trabajo, se estimó que aproximadamente 102 conidias/mL, es una concentración suficiente para inducir necrosis vascular de la madera.

Evaluación de la eficacia de BS (Extracto de Quillay) para el control de la pudrición gris (Botrytis cinerea) en uva de mesa

1 Sepúlveda, P.; 2 Salinas, G.; 1Rebufel, P. 1 Instituto de Investigaciones Agropecuarias Centro Regional de Investigación La Platina, Santiago, Chile 2Roberto Guzmán 8796, Las Condes, Santiago, Chile E-Mail: psepulve@inia.cl

La pudrición gris causada por el hongo Botrytis cinerea es una de las enfermedades más importantes de la uva de mesa. Sus síntomas son visibles después de envero y aumenta a medida que progresa la madurez hacia la cosecha. Requiere de humedad sobre 95 % y temperatura óptima de 20 º C. El control de la enfermedad es necesario, para obtener una fruta de calidad de exportación. El uso de fungicidas no químicos ha adquirido cada día mayor relevancia, con el fin de disminuir el nivel y número de moléculas residuales en la fruta. Con el objetivo de determinar la eficacia del producto natural BS (extracto de quillay), en el control de la pudrición gris de la vid, se realizó un ensayo la temporada 2011-12 en vides cv. Thompson Seedless, en la localidad de Isla de Maipo, evaluándose dos dosis (1 y 2 lt/ha) del producto, aplicado solo y alternado con fungicidas comerciales en dosis de 2lt/ha, comparado con el tratamiento del agricultor y un testigo sin control. El diseño fue de bloques al azar con 5 tratamientos y 3 repeticiones. La evaluación se efectuó al momento de cosecha, considerando para ello 25 racimos de cada tratamiento y repetición. Los parámetros analizados fueron: toxicidad, severidad e incidencia. Las condiciones climáticas (temperaturas y humedad) de la temporada, solo permitieron una expresión leve y poco homogénea de pudrición gris en la fruta del ensayo, logrando una incidencia de 18% en el tratamiento testigo. Los resultados obtenidos permiten indicar que BS disminuye significativamente la incidencia de Botrytis cinerea, con 2lt/ha tanto solo como alternado con los fungicidas, ya que en ambas condiciones se obtuvo menor incidencia que el testigo, para índice de daño de la enfermedad, todos los tratamientos evaluados se comportaron superiores al testigo. El producto BS no causó fitotoxicidad en ninguna de las dosis evaluadas tanto solo como en rotación.

Efecto del uso de Trichoderma spp. (Trichonativa ®), sobre el control de esclerocios de Botrytis cinerea, en vid vinifera cv. Syrah

1Donoso, E.; 2Maureira, M.; 1Cisternas, W. 1 Bio Insumos Nativa SPA, Maule, Chile 2 Fitonova Ltda. Maule Chile E-Mail: Edonoso@bionativa.cl

Botrytis cinerea es considerada una de las principales enfermedades en la producción de vid, siendo su control complejo. Uno de los estados del ciclo biológico del patógeno menos abordado en los planes de manejo, es su fase como esclerocio en el suelo. Considerando que estos representan una fuente relevante de inoculo, al inicio de la temporada, se planteó un estudio exploratorio con dos objetivos, establecer la relación entre esclerocios sobre la incidencia y severidad de la enfermedad y evaluar un agente de control de esclerocios, empleando un formulado comercial de Trichoderma spp. (Trichonativa®). El estudio se realizó en la VI Región, localidad de Palmilla, en un viñedo de 6 años del cv. Syrah, conducido en espaldera. El diseño fue completamente al azar, con arreglo factorial 2x2 (poblaciones de esclerocios sobre y entre hileras x aplicación o ausencia de Trichoderma). El Trichoderma fue aplicado con barra, a 1 L ha-1 , cuando los brotes alcanzaron los 15 cm. A la floración se evaluó la población de esclerocios viables por tamizado sobre la hojarasca y suelo provenientes de los 10 cm superiores por tamizado y la incidencia de Botrytis. Finalmente, se determinó la incidencia (% racimos con síntomas) y severidad (peso de bayas con síntoma por peso de total del racimo) en la cosecha. Se encontró una correlación directa y significativa entre cantidad de esclerocios sobre la hilera y la severidad de pudriciones (r= 0,818; r2 = 0,69; P<0,05).Las aplicaciones de Trichonativa®, lograron disminuir en forma significativa las poblaciones de esclerocios en un 80% (P<0,05), logrando esto generar una disminución de 23% en la incidencia (P<0,05) y en un 48% la severidad (p<0,05). Trichoderma spp. se presenta como un agente efectivo de control de esclerocios, con un impacto sobre la incidencia y severidad de esta enfermedad.

Caracterización molecular de aislados de Tomato ringspot virus (ToRSV) asociados a los cultivos de arándano y frambueso, en Chile

Rivera, L.; Zamorano A.; Fiore, N. Facultad de Ciencias Agronómicas, Universidad de Chile, Santiago, Chile. E-Mail: luciarivera@nemachile.cl

En el hemisferio sur, Chile es el principal exportador de “berries”; entre ellos, frutos de arándano y frambueso lideran las exportaciones. La producción se ha visto mermada a causa de infecciones virales cuyo control se basa en la prevención. Uno de los principales virus que afecta a estos cultivos es Tomato ringspot virus (ToRSV), transmitido naturalmente por diferentes especies de nematodos pertenecientes al grupo Xiphinema americanum. En huertos de arándano y frambueso que presentaban bajos rendimientos se detectó ToRSV a través de RT-PCR, utilizando dos parejas de partidores específicos D1/U1 y ToRSV-R/F. Los dos aislados virales se transmitieron y mantuvieron en plantas de Prunus tormentosa L., obtenidas de semillas y libres de virus. Adicionalmente, se diseñó una pareja de partidores que permitió amplificar el gen completo que codifica la proteína de la cápside (CP) de los dos aislados del virus. Con la secuencia completa (1687bp) del gen de la CP de ambos aislados chilenos y de aquellos procedentes de otras partes del mundo, se construyó un árbol filogenético. Ambos aislados se agruparon en el mismo clado junto a un aislado de frambueso cuyo origen es Estados Unidos y uno chileno previamente caracterizado y causante la enfermedad de la “línea parda en ciruelo”. Otras secuencias completas del gen que codifica la CP de aislados de frambueso y durazno desde Estados Unidos, se agruparon en un clado diferentes. A través de este estudio se ha caracterizado molecularmente, por primera vez en Chile, el gen que codifica la CP de aislados de ToRSV asociados a frambueso y arándano. El conocimiento de la secuencia del genoma de ToRSV permitirá aclarar si existe una relación específica entre cada variante genética del virus con una o más especies de nematodos del grupo X. americanum involucradas en la transmisión. Beca Conicyt Doctorado.

Caracterización fenotípica de cepas de Chondrostereum purpureum agente causal del plateado en arándano

Astete, P.1 , France, A.2 , Santelices, C.2 1 Facultad de Agronomía, Universidad de Concepción, Chillán, Chile 2 Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación Quilamapu, Chillán, Chile E-Mail: afrance@inia.cl

Según ODEPA, la superficie plantada de arándanos en Chile supera las 13.000 ha y una producción equivalente al 90% del total de Sudamérica. Este incremento ha estado asociado a una serie de enfermedades, entre las que destaca el Plateado, causado por el hongo Chondrostereum purpureum. Este patógeno afecta numerosas especies frutales y forestales en todo el mundo, sin embargo en arándanos solo ha sido reportado en Chile, con variaciones en sintomatología y susceptibilidad varietal. El objetivo de esta investigación fue caracterizar fenotípica y químicamente dos aislamientos de C. purpureum (Q711 y Q732), obtenidos desde plantas de arándanos con distintas expresión de síntomas en terreno. Para ambas cepas se realizaron evaluaciones morfológicas del micelio y basidiosporas, efecto de temperatura sobre el crecimiento de las colonias y producción de basidiocarpos. Entre ambos aislamientos el grosor de hifas fue la principal característica distintiva, con Q732 presentando el doble de diámetro que Q711. Otro carácter diferenciador fue el diámetro del esterigma, siendo Q732 un 58% mayor que Q711. Las temperaturas de crecimiento fueron similares para ambas, siendo 25°C el óptimo y 35°C la temperatura letal. Respecto a producción de basidiosporas, ambas fueron muy productivas y variables, con rendimientos entre 13 y 67 millones de esporas/cm2 de basidiocarpo. Los otros parámetros morfológicos no mostraron diferencias entre cepas. Otro carácter fue la producción de compuestos químicos de ambos aislamientos incubados en medios líquidos, los que mostraron diferencias importantes en número y cantidad. Q711 produjo 16 compuestos identificados y 26 no identificados, mientras que Q732 produjo 11 y 27, respectivamente, diferenciándose entre ellas en 26 compuestos. Por último, se inocularon ramillas de 15 variedades comerciales de arándanos, indicando que Q732 fue la que produjo mayor colonización en las distintas variedades. En consecuencia, existen diferencias fenotípicas entre aislamientos, lo que podría explicar las distintas manifestaciones sintomáticas en terreno. Financiamiento Fondecyt. Proyecto N° 1120978

Diversidad genética en Chondrostereum purpureum, una enfermedad de importancia económica en arándano

1Rojo, C.; 1 Becerra, V.; 2 France, A.; 1 Paredes, M.; 2 Santelices, C. 1 Laboratorio de Biotecnología, Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación Quilamapu, Chillán, Chile 2 Laboratorio de Fitopatología, Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación Quilamapu, Chillán, Chile E-Mail: carmenrojo@udec.cl

En Chile, el cultivo del arándano se ha visto afectado por una nueva enfermedad de origen fúngico produciendo una baja en los rendimientos, muerte progresiva de plantas y pérdida de huertos. El agente causal es Chondrostereum purpureum (Pers.), hongo que causa el plateado. Esta enfermedad no ha sido reportada en arándano en ninguna parte del mundo, incluyendo la zona de origen y distribución natural de este frutal (Norte América), donde la planta coexiste con este hongo. Por ser el plateado una nueva enfermedad en el arándano, es de gran interés contribuir al conocimiento básico de la especie para describir, en forma complementaria a la caracterización morfológica, las características genéticas de la especie misma. El uso de marcadores moleculares ha contribuido al estudio de patógenos, es así como dentro del ADN nuclear ribosomal (rADN) los ITS son regiones que acumulan mutaciones y que han permitido establecer diversidad entre poblaciones de hongos. Por lo cual, el objetivo de esta investigación es determinar la diversidad genética de poblaciones de C. purpureum recientemente colectadas en la zona Centro Sur y Sur de Chile. El ADN de 119 cepas se extractó con CTAB (2%). La amplificación se realizó mediante los ITS1F e ITS4B. Los resultados preliminares obtenidos mediante ITS-RFLP indican que existe una alta diversidad genética en las poblaciones colectadas entre las regiones de Los Ríos y del Maule. El coeficiente de similitud promedio fue de 0.76 (Jaccard). Dos grandes grupos genéticamente distintos se observan en el dendrograma, aunque su diversidad no esta asociada al origen geográfico ni al huésped desde donde fueron colectadas las muestras. Financiamiento: Fondo Nacional de Desarrollo Científico y Tecnológico (Fondecyt) Nº 1120978

Tizón foliar en zanahoria: caracterización fenotípica y molecular de los agentes causales asociados

1 Araya, C.; 1 Salazar, E.; 2 Sepúlveda, P. 1Unidad de Recursos Genéticos, Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación La Platina, Santiago, Chile 2 Laboratorio de Fitopatología, Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación La Platina, Santiago, Chile

La zanahoria (Daucus carota L) es la quinta hortaliza con más superficie sembrada en el país. Su cultivo se extiende desde la región de Arica y Parinacota a la del BíoBío. Uno de los principales problemas fitosanitarios de este cultivo es la enfermedad causada por Alternaria spp. Un estudio reciente, realizado en la localidad de ChiuChiu, región de Antofogasta, identificó las especies A. alternata (reconociéndose cuatro grupos fenotípicos denominados 1, 2, 4, 3) y A. radicina. Sin embargo, la asociación entre la diversidad fenotípica con la posible diversidad genética de estos hongos patógenos, y la relación con la respuesta diferencial al control químico son temas pendientes. El objetivo de este estudio fue profundizar en las características de crecimiento en distintos medios de cultivo, el nivel de sensibilidad a fungicidas y la diversidad genética de distintos aislados de Alternaria encontrados en dicha localidad. A partir de semillas germinadas y hojas sintomáticasde zanahoria se obtuvo aislados monoconidiales. Posteriormente, se caracterizó el crecimiento de los aislados en distintos medios de cultivo (agar papa dextrosa, agar papa zanahoria, agar malta sal). La sensibilidad a los fungicidas boscalid, iprodione, pyraclostrobin y difenoconazole, se determinó a través de la EC50. Luego, se efectuó la identificación molecular a nivel de especie a través de PCR con partidores específicos y secuenciación de la región ITS del ADNr. La diversidad genética intraespecífica se determinó mediante microsatélites. De las muestras recolectadas se obtuvo 18 aislados monoconidiales. En base al crecimiento en los distintos medios de cultivo, los dieciocho aislados se diferenciaron en tres grupos fenotípicos de los 4 grupos previamente reconocidos. La identificación molecular permitió el reconocimiento de A. alternata en doce de los dieciocho aislados (siete aislados del grupo 1, un aislado del grupo 3 y cuatro aislados del grupo 4). Las herramientas moleculares utilizadas (PCR específico y secuenciación) no permitieron la asignación de especie en seis aislados. Los seis aislados no identificados presentaron una menor sensibilidad a los fungicidas boscalid, pyraclostrobin y difenoconazole, en comparación con los aislados identificados como A. alternata. Actualmente se están realizando los análisis para determinar la diversidad intraespecífica, a partir de los datos obtenidos mediante microsatélites.

Caracterización fenotípica y molecular de aislados de Neonectria fuckeliana, hongo causante de cancros fustales en plantaciones de Pinus radiata, Chile

1González, C.; 2Riegel, R. 1 Escuela de Graduados, Facultad de Ciencias Forestales y Recursos Naturales, Universidad Austral de Chile, Valdivia, Chile 2 Facultad de Ciencias Agrarias, Universidad Austral de Chile, Valdivia, Chile E-Mail: cristian.gonzalez@alumnos.uach.cl

Neonectria fuckeliana es un hongo descubierto el año 2008 en Chile, Región de la Araucanía, causando cancros y malformaciones fustales en plantaciones de Pinus radiata. Este hongo, endémico del hemisferio norte actúa como saprofito o débilmente patógeno sobre coníferas en su lugar de origen, sin embrago, en Nueva Zelanda y Chile se ha detectado actuando como patógeno en plantaciones podadas de P. radiata. El objetivo del presente estudio fue caracterizar de forma fenotípica y molecular aislados de N. fuckeliana provenientes de distintas poblaciones de las Regiones de La Araucanía (Carahue, Toltén, y Pucón) y Los Ríos (Paillaco), Chile. La caracterización fenotípica consistió en evaluar color de colonias, tasas de crecimiento y tamaño de conidias, mientras que la caracterización molecular consistió en transferir partidores SSR desde N. ditissima a N. fuckeliana, además de probar partidores ISSR y secuenciar segmentos de ADNr 18S y ITS. Fenotípicamente se identificaron tres colores de colonia definidos, que van desde el rojo al amarillo pálido. Los aislados con mayores tasas de crecimiento correspondieron a los de Pucón con 4,8 mm de crecimiento diario. En cuanto al tamaño de conidias estos variaron entre 2,40 y 2,54 µm para el ancho, mientras que largo fue entre 4,94 y 5,24 µm, donde los aislados de Carahue presentaron los mayores tamaños con 2,54 y 5,24 µm para ancho y largo respectivamente. En cuanto a la caracterización molecular, la transferencia de partidores SSR entre las dos especies no fue efectiva y los partidores ISSR no fueron constantes en sus resultados. La secuenciación de las regiones de ADNr 18S y ITS, indicaron que no existen diferencias entre los aislados del estudio, al igual que con secuencias homologas de Europa y Nueva Zelanda.

Uso de distintas concentraciones de Fluquinconazole como tratamiento de semillas para el control del Mal del Pie del trigo, causada por Gaeumannomyces graminis var. tritici, aislamiento GGT2010-04

1 Vera, C.; 1Moya-Elizondo, E.; 2Matus, I.; 3 Jobet, C.; 2Madariaga, R. 1 Facultad de Agronomía, Universidad de Concepción, Chillán, Chile 2 Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación Quilamapu, Chillán, Chile 3 Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación Carillanca, Vilcún, Chile E-Mail: carolavera@udec.cl

El Mal del Pie es considerado como una de las enfermedades más destructivas del trigo y de otros cereales en Chile. El tratamiento de semillas con fungicidas, a pesar de no ser completamente efectivo, ha mostrado ser una valiosa herramienta para atenuar la enfermedad, especialmente en situaciones de rotaciones riesgosas. Durante la temporada de cultivo 2012 se realizó un experimento en diseño de bloques al azar con el trigo invernal cv. Maxwell INIA en la Estación Experimental INIA Santa Rosa en Chillán, se incluyeron cinco tratamientos de semillas con diferentes concentraciones de Fluquinconazole (0, 150, 175 y 200 cc p.c. 100kg-1 ) solo y en mezcla con Prochloraz (200 cc p.c. 100kg-1 ). El suelo fue contaminado artificialmente con granos de avena portadoras del aislamiento patogénico de Gaeumannomyces graminis var. tritici INIA GGT 2010-04, el cual presenta una alta virulencia y agresividad. La inoculación se realizó en el surco de siembra, en una proporción 2:1 de granos de trigo: granos de avena. Los cuatro tratamientos desinfectantes a la semilla fueron eficaces en el control de Mal del pie, destacando la dosis 200 cc p.c. 100 kg-1 de semilla de Fluquinconazole. Los tratamientos con Fluquinconazole en sus tres dosis estudiadas de 150, 175 y 200 cc p.c. 100 kg-1 tuvieron un comportamiento y rendimiento estadísticamente similar a la formulación comercial de Fluquinconazole + Prochloraz, con incrementos de rendimiento entre 26 y 38 % sobre el testigo inoculado [rinde= 62,9 qqm/ha]. A pesar de que ninguno de los desinfectantes controló el 100 % de la enfermedad, se logró un aumento de 32 % del rendimiento, se mejoró el peso de hectólitro en 6,6 % y se incrementó el índice de cosecha de las plantas entre 17,5 y 21,6 % en relación al testigo inoculado y sin tratar. Se logró dimensionar el potencial destructivo de la enfermedad en el cv. Maxwell y se concluye que el uso de distintas concentraciones de Fluquinconazole es promisorio para el control del mal del pie del trigo en la zona sur de Chile.

Efecto de la presión de oxígeno en la calidad microbiológica del té de compost utilizado en el control de enfermedades

Briceño, E. Facultad de Ciencias Agrarias, Universidad Austral de Chile. Campus Isla Teja, Valdivia E-Mail: erika.briceno@uach.cl

El té o extracto acuoso de compost se utiliza frecuentemente para el control de patógenos de cultivos agrícolas, mediante la inoculación de una alta población de microorganismos que potenciará la resistencia de las plantas y de los suelos. Con el objetivo de obtener té de compost de calidad para la aplicación de la parte aérea de plantas de arándano para el control de Botrytis cinerea, se realizaron pruebas de producción de té de compost con distinta presión de oxígeno (0, 10, 20 ppm) y se evaluó la calidad microbiológica del té de compost obtenido. Para ésto, se preparó té de compost con un equipo Earthfort (Oregon, USA) y midiendo el oxígeno disuelto con un sensor termocompensado (0-20 ppm). Se realizó la determinación de las poblaciones bacterianas mediante diluciones seriadas en Medio B de King (MBK) y para evaluar la calidad microbiológica se utilizó los medios Lauril sulfato, bilis verde brillante 2%, Eosin Metil Agar y EC broth, para detectar la presencia de coliformes fecales y Escherichia coli, en los preparados. De acuerdo a los resultados obtenidos con las distintas preparaciones, podemos concluir que para obtener té de compost de calidad debe mantenerse una concentración de oxígeno disuelto de alrededor de 20 ppm, para incrementar las poblaciones de Pseudomonas, Bacillus o bacterias nitrificantes y evitar la proliferación de microorganismos aeróbicos facultativos o anaeróbicos presentes con concentraciones deficientes de oxígeno (coliformes fecales, E. coli), indeseados para la producción orgánica. Financiado por Fondecyt Postdoctorado 3120168.

Evaluación de la capacidad biocontroladora de nemátodos in vitro por hongos filamentosos nativos

1 Vidal, A.; 2 Pérez, G.; 3 Aldunate, R.; 2Carú, M. 1 Escuela de Biotecnología, Universidad Santo Tomás, Santiago, Chile 2 Facultad de Ciencias, Universidad de Chile, Santiago, Chile 3Universidad Santo Tomás, Santiago, Chile E-Mail: araceli.vidal.a@gmail.com

Las plantas establecen estrechas asociaciones con la microbiota del suelo, generándose diversas interacciones ecológicas entre especies. Como por ejemplo; nemátodos fitoparásitos que invaden e infestan las raíces de las plantas causando distintas patologías y hongos filamentosos capaces de controlar y/o depredar fitopatógenos del suelo. Esta propiedad de los hongos se propone como una alternativa ecológica para biocontrolar nemátodos fitoparásitos y así disminuir el uso de agroquímicos. En este trabajo se implementó un modelo experimental para cuantificar y evaluar la capacidad nematicida in-vitro de hongos filamentosos. En los experimentos se usó como modelo de estudio al nemátodo Caenorhabditis elegans y se evaluó la capacidad biocontroladora de hongos aislados en Chile que corresponden a tres cepas de la especie Paecilomyces lilacinus (N2, AH79.1, AH59.1) y una cepa de Trichoderma harzianum (T7). Para los ensayos se utilizaron microplacas de 96 pocillos y se realizaron 12 tratamientos con 10 repeticiones cada uno, más controles sin hongos. En el tiempo cero se sembraron 8-10 nemátodos por pocillo y se evaluó la población de nemátodos en presencia de distintas concentraciones de esporas (2X102 , 2X103 y 2X104 esporas/pocillo) de cada hongo. El sistema se mantuvo a 20°C por 16 días a 150 rpm. Se contó el número de nemátodos los días 2, 5, 9, 12 y 16. Con los resultados obtenidos se realizó una curva de crecimiento poblacional de los nematodos en fase exponencial. Los resultados muestran que la velocidad de crecimiento de la población de nemátodos disminuyó en función de la concentración de esporas, obteniéndose la menor densidad poblacional en el día 12 a una concentración de 2X104 esporas/pocillo. La cepa AH59.1 de P. lilacinus mostró el mejor efecto biocontrolador y los datos sugieren que estos hongos podrían ser utilizados para generar productos para el biocontrol de nemátodos fitoparásitos.

Diaporthe australafricana causando cancro de tallo y muerte regresiva en avellano europeo (Corylus avellana L) en Chile

Guerrero, J.; Pérez, S.; Bensch, E.; Vidal, A. Departamento de Producción Agropecuaria, Universidad de La Frontera, Temuco, Chile E-Mail: jaime.guerrero@ufrontera.cl

El cultivo del avellano europeo aumenta sostenidamente en el sur de Chile, y enfermedades de la madera son frecuentes. Ramas y ramillas, con cancros café grisáceo y decoloración rojiza del sistema vascular, presentes en el cultivar Barcelona (Panguipulli, Región de Los Ríos, 2012), fueron desinfectadas con hipoclorito de sodio al 0,5 % por 2 minutos y lavadas con agua destilada, previo a dejar trozos en cámara húmeda (25 ± 2 ºC). En esta condición se desarrollaron peritecios negros sub-epidérmicos con ascosporas unitunicadas, cilíndricas y clavadas; las ascosporas septadas, hialinas, multigutuladas y suavemente constreñidas en el septum, tamaño 13.4 µm ±0.6 × 3.9 µm ±0.2. Desde ascosporas en APD incubadas en oscuridad durante 6 días (25ºC), puntas de hifas fueron transferidas a APD, desarrollándose micelio algodonoso blanco crema, y picnidios con alfa conidios unicelulares hialinos y bigutulados (6.1-7.2 µm × 2.8-3.1 µm), beta conidias no fueron observadas en medio de cultivo. La identificación del aislado IMI- 501237 fue confirmado en el CABI mediante ITS, rDNA, BLASTn, analizando 524-bp, que mostró 100% de homologación con Diaporthe australafricana Crous &J.M. van Niekerk (accesión KC343039 y KC343038), estas características morfológicas y moleculares fueron similares a las reportadas para este hongo desde vid y arándano. La secuencia fue depositada en el GenBank (accesión Nº JX316218.1). La patogenicidad del aislamiento IMI 501237 en plantas de cuatro años del cultivar Barcelona, fue verificada mediante inoculación sobre heridas frescas en tres tallos y en 5 yemas vegetativas en ramillas, se inoculó con micelio en agar, cubriendo con algodón húmedo y sellado con parafilm; los testigos fueron inoculados con agar. Transcurrido 30 días fueron más evidentes lesiones necróticas, trozos de este tejido inoculado fue incubado en APD; Diaporthe australafricana fue consistentemente recuperada, satisfaciendo los postulados de Koch. Constituye el primer reporte de Diaporthe australafricana en avellano europeo cultivar Barcelona, en el mundo. Financiamiento: Proyecto DIUFRO DI13-0033.

Atizonamiento y cancro de tallos y ramillas, causado por Diplodia coryli L. en avellano europeo (Corylus avellana L. ) en el sur de Chile

Guerrero, C.; Pérez, F.; Sobarzo, M.; Salgado, B.; Alvarado, N. Departamento de Producción Agropecuaria, Universidad de La Frontera, Temuco, Chile E-Mail: jaime.guerrero@ufrontera.cl

Las enfermedades en avellano europeo están siendo estudiadas recientemente en el sur de Chile. Es frecuente observar en plantaciones comerciales, muerte regresiva de ramillas y cancros grisáceos de aspecto rugoso en tallos. Ramillas sintomáticas del cv. Barcelona provenientes de localidad Allipén, Región de La Araucanía, temporada 2011; fueron desinfectadas en NaClO, lavadas con agua destilada estéril y mantenidas en cámara húmeda; se desarrollaron picnidios maduros sub epidérmicos y conidios se transfirieron a Agar Papa Dextrosa (APD) e incubaron a 25ºC; el micelio fue de coloración negra, apariencia rastrera y compacto. Los conidios café oscuro, ovoides, suevamente constreñidos en el septo, de ápice redondeado y algunos con base truncada, (20.0µm-) 23.1 µm ±1.9 µm (-28.0 µm) × (10- µm)11.9 µm ±1.2µm (-15 µm), relación largo/ancho 1,95µm±0,17µm, (n=50); características morfométricas de Diplodia coryli Fuckel (1870), teleomorfo: Botryosphaeria sensu lato. La identificación fue confirmada mediante secuenciación completa ITS de rDNA, realizada en el CABI, La secuenciación del aislamiento (IMI-501235a), tuvo 100% de homología con cepa de referencia (CBS 242.51) y fue depositada en el GenBank (Accesión JX163116). La patogenicidad se realizó en cuatro plantas de 1 año cv. Barcelona, mantenidas en macetas en invernadero (14/10 oscuridad/luz, 20°C, 70%HR); dos tallos y tres ramillas (alrededor de yema vegetativa) desinfectados con NaClO (2%) y enjuague con agua destilada estéril, fueron inoculados con micelio en agar (de 7 días) y se cubrió con algodón humedecido y Parafilm, la planta control se inoculo solo con agar. Después de 3 meses, Diplodia coryli se reaisló en APD desde trozos de tejidos necróticos inoculados, corroborando los postulados de Koch. La planta control no mostró síntomas. Se reporta a D.coryli como causante de muerte regresiva de tallos y ramillas, en Italia y España. Este es el primer reporte de D. coryli en Avellano europeo cv Barcelona, en Chile. Financiamiento: Proyecto DIUFRO DI13-0033.

Inoculante microbiano en base a cepas nativas de hongos Trichoderma y bacterias Pseudomonas

1 Almasia, R.; 2Muñoz, V.; 1 Flores, P.; 1Handford, M. 1 Facultad de Ciencias, Universidad de Chile, Santiago, Chile 2 Facultad de Ciencias, Universidad Santo Tomas, Santiago, Chile E-Mail: romina.almasia@gmail.com

Chile posee diversos ambientes desde los cuales es posible recuperar una inmensa diversidad microbiana con enorme potencial biotecnológico. En una búsqueda por recuperar parte de este potencial y centrándonos en la caracterización de cepas con efectos bioestimulantes se ha estado trabajando con dos hongos y dos bacterias de suelo del sur de Chile con interés aplicado. En el laboratorio se caracterizó bioquímicamente las bacterias utilizando medios selectivos y reacciones como agar citrato, King-B, licuefacción de gelatina, hidrólisis de almidón, análisis de catalasa, tinción Gram y producción de HCN, demostrando preliminarmente la pertenencia al género Pseudomonas. Luego, se evaluó molecularmente las 4 cepas utilizando los marcadores rna18S, ITS1 y rna16S, se identificó las secuencias mediante TrichoBLAST-NCBI y se analizaron con MEGA5. De esta manera se identificaron 2 cepas de Trichoderma y se confirmó la pertenencia de las bacterias al género Pseudomonas. Luego, se analizó el efecto de los microorganismos a través de ensayos en invernadero sobre plantas de tomate dispuestas en maceteros, al embeber los platines en distintos tratamientos y concentraciones. Algunos tratamientos presentaron un aumento en el peso y número de tomates por planta, y en la maduración de los frutos. Estos efectos no fueron acompañados por un mayor crecimiento vegetativo de la planta. Se evaluó parámetros para su aplicación comercial como: 1) Viabilidad en el tiempo; la formulación para hongos posee una viabilidad máxima de 1 año y la de bacteria de al menos 3 meses, y 2) Compatibilidad con fungicidas; las bacterias fueron compatibles con Serenade, Bellis, entre otros y los hongos con Mancozeb, Captan, entre otros. Actualmente, se cuenta con una mezcla de microorganismos nativos con respuestas bioestimulantes en plantas observadas en pruebas preliminares, y con efectos que superan a productos comerciales (Uniroot-GreenUniverse). Ensayos de campo en suelo con agricultores están en curso. Financiamiento: Proyecto FONDEF-VIU 110031.

Control químico de Fusarium oxysporum f.sp fragariae en el cultivo de frutilla

1Rodriguez, M.; 2 Sepúlveda, P.; 1Délano, G.; 2Rebufel, P. 1Universidad Santo Tomas, Santiago, Chile 2 Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación La Platina, Santiago, Chile E-Mail: melany.prb@gmail.com

El cultivo de frutilla alcanza una superficie plantada en el país de 1.498,2 ha, destinando su producción en un 60% al mercado nacional y un 40% a exportación, principalmente congelada. El hongo Fusarium oxysporum f.sp fragariae, es el principal patógeno asociado a marchitez y muerte de plantas en Chile. A nivel mundial su control es difícil, debido a que existen pocas alternativas químicas validadas. Para establecer el efecto de los ingredientes activos (i.a.): Azoxystrobin, Cyprodinil+ Fludioxonil e Iprodione en el control de Fusarium oxysporum f.sp fragariae sobre el cultivo de frutilla, en una primera etapa, se validó el efecto in vitro de estos productos aplicados en placas con APD a una concentración de 1, 5 y 10 ppm respectivamente, determinándose los valores EC50. Las evaluaciones se realizaron luego de 3, 7 y 10 días de incubación. En este caso, el i.a. que inhibió crecimiento del hongo por sobre el 70% con respecto al testigo fue cyprodinil+fudioxonil. Posteriormente, en plantas inoculadas de frutilla var. Camarosa establecidas en macetas, se evaluó el efecto de control sobre la enfermedad de los i.a. aplicados vía riego en forma preventiva, curativa y preventiva/curativa. En un tercer ensayo de campo, con plantas de frutilla var. Aroma previamente inoculadas, se evaluó el efecto de tratamientos curativos de la enfermedad, con los productos aplicados por quimigación. Los resultados obtenidos señalan que cyprodinil+ fludioxonil aplicado preventiva y curativamente controló de una manera eficaz la fusariosis en frutilla var. Camarosa establecida en condiciones de sombreadero; resultados similares se obtuvieron en frutillas var. Aromas establecidas en campo, donde el mejor control se alcanzó un con cyprodinil+ fludioxonil aplicado por quimigación en forma curativa.

Nuevos reportes de hongos asociados a Eucalyptus spp. en Chile

1Opazo, A.; 2 Zapata, M. 1División Protección Agrícola y Forestal, Servicio Agrícola y Ganadero, Santiago, Chile 2 Laboratorio Regional Chillán, Servicio Agrícola y Ganadero, Chillán, Chile E-Mail: alex.opazo@sag.gob.cl

En Chile, existen más de 660.000 ha de plantaciones de Eucalyptus spp., principalmente de Eucalyptus globulus y E. nitens. Además, se presentan especies del género Eucalyptus plantadas con fines ornamentales en ambientes urbanos y rurales. El Servicio Agrícola y Ganadero (SAG) realiza actividades de vigilancia forestal, tanto en las plantaciones comerciales como en especies ornamentales del género Eucalyptus, con el objeto de detectar en forma precoz aquellas plagas cuarentenarias y otras plagas ausentes del país que puedan afectar este cultivo. Para la detección de especies fungosas, se realizan encuestas (prospecciones), y en los casos donde se sospecha la presencia de plagas, se envían muestras para análisis en la red de laboratorios especializados del SAG, donde se realiza la identificación de los patógenos mediante el empleo de taxonomía tradicional basadas en caracteres morfológicos y/o con el apoyo de técnicas moleculares, si se estima necesario. En base a los registros de informes fitosanitarios del Sistema de Información de Sanidad Vegetal (SISVEG) del SAG, se encontró que la mayor cantidad y diversidad de hongos asociados a Eucalyptus spp. en Chile se asocian al follaje, además, se encontraron especies de hongos no reportadas previamente en el país asociado a Eucalyptus spp., entre los que destacan Mycosphaerella communis, Cytospora eucalypticola, Mycosphaerella aurantia y Mycosphaerella madeirae. En las plantaciones de Eucalyptus spp., no se han detectado daños de importancia ocasionados por estas especies, y no se encontraron antecedentes de daños en plantaciones de otros países, por lo que estima que no representan un riesgo para las plantaciones de eucalipto en Chile. Mediante las actividades de vigilancia forestal que realiza el SAG no se han detectado especies de hongos que sean plagas cuarentenarias en Eucalyptus spp.

Raffaelea lauricola, una nueva plaga cuarentenaria para Chile

Morales, A.; Murillo, M.; Niccoli, C. Servicio Agrícola y Ganadero, SAG, Santiago, Chile E-Mail: andrea.morales@sag.gob.cl

El Servicio Agrícola y Ganadero es la autoridad oficial encargada de velar por el patrimonio fitosanitario del país. Al respecto, realiza una búsqueda permanente de plagas emergentes a nivel mundial, evaluándolas mediante el Análisis de Riesgo de Plagas (ARP), el cual con evidencias biológicas, científicas y económicas determina si deben ser reglamentadas. En este contexto, en Estados Unidos durante el año 2003 se describió la enfermedad vascular “marchitez del laurel” ocasionada por el hongo Raffaelea lauricola (Ascomycetes, Ophiostomatales) cuyo vector es Xyleborus glabratus (Coleoptera, Scolytidae). Esta enfermedad se ha considerado una grave amenaza para la producción de Persea americana. R. lauricola es transportada en las micangias del vector, ocurriendo la infección cuando X. glabratus realiza galerías en árboles sanos introduciendo el hongo hasta el xilema. El principal daño es la restricción del flujo de agua, observándose en el follaje síntomas de marchitez, coloración rojiza y necrosis, pudiendo permanecer en las ramas por más de un año. Internamente, en la albura se desarrollan manchas oscuras de diferentes longitudes, y en árboles muertos se observan los agujeros del vector. Los hospedantes reportados son: P. borbonia, P. palustris, P. americana, Sassafras albidum, Lindera melissifolia, Cinnamomum camphora y Litsea aestivalis. En Chile, existen hospedantes susceptibles y zonas con condiciones climáticas favorables tanto para el vector como para el hongo, por lo que el ingreso de esta plaga al país podría impactar negativamente, calificando con un riesgo alto. Por lo tanto, se concluye que R. lauricola califica como plaga cuarentenaria ausente para Chile, por lo cual fue incluida en la última actualización de la Resolución que establece el listado de plagas cuarentenarias para Chile.

Antagonismo in vitro de tres cepas de Trichoderma spp. a Phytophthora infestans

Andrade, N.; Valenzuela, C.; Doussoulin H. Instituto de Producción y Sanidad Vegetal, Facultad de Ciencias Agrarias, Universidad Austral de Chile E-Mail: nandrade@uach.cl

El tizón tardío de la papa causado por Phytophthora infestan, es la enfermedad más importante y devastadora en este cultivo. Considerando los cuestionamientos de productos químicos para el control de patógenos, surgen nuevas alternativas como el hongo Trichoderma spp. muy utilizado en control biológico. El objetivo de esta investigación fue determinar la capacidad de biocontrol de dos cepas Trichoderma harzianum (1), T. harzianum (2) y una cepa de T. viride. Se depositó un disco de 5 mm de diámetro, con micelio de cada cepa de Trichoderma, de tres días de crecimiento en Agar Centeno a 24º C, en un extremo de la placa y en el otro extremo a 6 cm de distancia, se colocó un disco de igual tamaño con micelio de P. infestans. Este último sembrado a las 0, 48, 96 y 144 horas antes de la incorporación del biocontrolador. Se realizaron 5 repeticiones por cada cepa de Trichoderma evaluado y los tratamientos testigos. Los datos fueron analizados mediante ANOVA y Test de Tukey. Se midió el diámetro en milímetros (mm) de la zona de avance de las colonias en los diferentes tiempos. Se calculó el porcentaje de inhibición de P. infestans logrado por las cepas de T. harzianum, utilizando la escala de medición de BELL et al, 1982. En todos los tratamientos se observó desarrollo de P. infestans. T. harzianum 2 presentó un porcentaje de inhibición de 90%, la cepa T. viride de 72% y para la cepa T. harzianum 1 el porcentaje de inhibición fue de 51%. La cepa T. harzianum 2 además mostró antibiosis. Las cepas de Trichoderma harzianum 1 y T viride evaluadas presentaron resultados promisorios para ser utilizadas en el control de P. infestans; sin embargo, se requieren pruebas bajo condiciones de campo, para obtener información que respalde los resultados obtenidos in vitro.

Fitopatógenos cuarentenarios en nogal (Juglans regia) y manejo del riesgo de plaga

Biscupovich, S. Servicio Agrícola y Ganadero, SAG, Santiago, Chile E-Mail: susana.biscupovich@sag.gob.cl

El Servicio Agrícola y Ganadero (SAG), como Organización Nacional de Protección Fitosanitaria, tiene la responsabilidad de establecer la reglamentación fitosanitaria para la importación de productos de origen vegetal, a fin de prevenir la introducción de plagas cuarentenarias que afecten a la producción agrícola y forestal, armonizada con estándares internacionales sobre medidas fitosanitarias de la Convención Internacional de Protección Fitosanitaria (CIPF) y el Acuerdo de la Organización Mundial del Comercio (OMC), dentro de los cuales se encuentra el procedimiento del Análisis de Riesgo (ARP) para Plagas Cuarentenarias. De acuerdo a solicitudes de autorizaciones de importación presentadas al SAG por importadores chilenos, se establecieron las regulaciones para importar plantas de nogal provenientes de los Estados Miembros de la Comunidad Europea (CE) y de Estados Unidos de Norteamérica, y material de propagación in vitro de cualquier origen, para lo cual se elaboraron los correspondientes ARP, identificando a los fitopatógenos cuarentenarios y estableciendo los Requisitos Fitosanitarios y Declaraciones Adicionales requeridos para el Manejo del Riesgo de Plaga de cada patógeno. Los hongos Cylindrosporium juglandis y Melanconis juglandis se establecen como plagas cuarentenarias para plantas de nogal provenientes de Estados Unidos; Erwinia rubrifaciens se regula para plantas procedentes de los países de la CE y Estados Unidos; y Cherry leaf roll virus es considerado cuarentenario en plantas provenientes de ambos orígenes y en material in vitro de cualquier origen, con presencia de esta plaga.El Manejo del Riesgo de cada fitopatógeno considerado como plaga cuarentenaria se establece en la reglamentación fitosanitaria de importación como Requisitos Fitosanitarios y Declaraciones Adicionales, los que deben constar en el Certificado Fitosanitario oficial de la autoridad fitosanitaria del país de origen del material vegetal, además de las regulaciones para otro tipo de plagas.

Resultados de prospección específica de Monilinia fructicola (Winter) Honey, patógeno bajo control oficial en Chile

1Murillo, M.; 2Chávez, E.; 2Martínez, C. 1 Servicio Agrícola y Ganadero, División Protección Agrícola y Forestal, SAG, Santiago, Chile 2Departamento Laboratorios y Estaciones Cuarentenarias, SAG E-mail: mariaeugenia.murillo@sag.gob.cl; eduardo.chavez@sag.gob.cl; carolina.martinez@sag.gob.cl

El Servicio Agrícola y Ganadero (SAG) mediante la Resolución Exenta Nº 6.412 del año 2012, declaró el Control Oficial de Monilinia fructicola, agente causal de pudrición morena de los carozos, moniliasis o tizón de la flor. A través de este Programa, el SAG durante el otoño del presente año, ha realizado la prospección específica para la detección del hongo en frutales de carozos, la cual abarca desde las regiones de Coquimbo a la del Maule. Las muestras colectadas fueron principalmente frutos sintomáticos y los diagnósticos de la plaga han sido realizados mediante caracterización de la colonia y análisis molecular de PCR con partidores específicos validados por la EPPO y confirmados por secuenciación de ADN. Los resultados totalizan 148 predios positivos a nivel nacional, distribuidos en las regiones Metropolitana, O´Higgins y del Maule permaneciendo a la fecha ausente en las regiones de Coquimbo y Valparaíso. Las especies afectadas corresponden a nectarino (Prunus persica var. nucipersica), duraznero (Prunus persica), ciruelo europeo (Prunus domestica) y ciruelo japonés (Prunus salicina). Derivado de esta misma actividad, en la región de O´Higgins se ha determinado M. fructicola en pomáceas, en huertos de peral (Coltauco), de manzano (Coltauco, Graneros, Rengo, Requinoa y Malloa) y en membrillero (Graneros y Rancagua), en todos los casos, estos predios se encontraban aledaños a carozos altamente infestados con la plaga. El Servicio a nivel nacional continuará con las actividades de vigilancia de la plaga en la temporada de primavera, como asimismo, con las actividades de fiscalizaciones en las áreas que se encuentran bajo Control Oficial (predios positivos y área reglamentadas).

Determinación de los umbrales microclimáticos incidentes en la liberación de conidias de Botrytis cinerea en un cultivo de lechugas bajo invernadero, en la Región de los Ríos

1 Beluzan, F.; 2 Andrade, N.; 2 Acuña-López, R. 1 Escuela de graduados, Facultad de Ciencias Agrarias Universidad Austral de Chile, Valdivia, Chile 2 Instituto de Producción y Sanidad Vegetal, Facultad de Ciencias Agrarias Universidad Austral de Chile, Valdivia, Chile E-Mail: franciscobeluzan@gmail.com

La pudrición gris, causada por Botrytis cinerea, es una de las enfermedades más comunes en lechugas bajo invernadero en el sur de Chile. Debido a las condiciones ambientales características de la Región de los Ríos, el cultivo de lechuga está constantemente predispuesto a esta enfermedad. Al estar la incidencia de este patógeno estrechamente relacionada con la cantidad de conidias circulantes en el ambiente, surge la necesidad de determinar las condiciones propicias de la esporulación, para así, manejarlas mediante control microclimático preventivo de B. cinerea, en invernadero. Por lo anterior se planteó como objetivo de esta investigación, determinar el umbral de DPV, temperatura y humedad relativa, que generó un aumento en la liberación de conidias de B. cinerea, en lechugas cv. Justine, bajo invernadero, durante enero-febrero de 2013. Se implementaron trampas de esporas con medio selectivo para B. cinerea y B. allii semanalmente en invernadero, se retiraron después de 8 h y se incubaron a 22°C en estufa (72 h). Se contaron las unidades formadoras de colonias y se correlacionaron con el DPV, temperatura y humedad relativa (registradas con un datalogger). También se midió la incidencia relativa de infecciones en cada muestreo. Se demostró que la liberación de conidias aumentó cuando los valores de DPV y temperatura fueron inferiores a 0,6 kPa y 21°C, respectivamente, y superiores a 85% de humedad relativa. Al disminuir la liberación de conidias, la incidencia también lo hizo. Como conclusión, se estableció que la liberación de conidias, incrementó la incidencia de pudrición gris cuando el microclima rodeó los 0,6 kPa, 21°C y 85%, de DPV, temperatura y humedad relativa, respectivamente. En base a estos resultados, intervenir el microclima, mediante ventilación pasiva, podría disminuir la predisposición para el desarrollo de B. cinerea, generando un manejo fitosanitario sustentable del cultivo de lechugas.

Meloidogyne incognita, M.arenaria, agentes causales de los síntomas de nódulos radicales, en cultivo de Lisianthus (Eustoma grandiflorum L.) en invernadero frío, Curacaví, Región Metropolitana

1 Arancibia, R.; 2 Tapia, E.; 2Narváez, A.M.; 1 Alvarado, C.; 1 Arraño, L. 1 SAT-Flores, Curacaví, Región metropolitana 2 Laboratorio de análisis de Valparaíso, Servicio Agrícola y Ganadero E-Mail: rosa.arancibia@cifra.cl

El cultivo de Lisianthus para flor de corte lo realizan diez productores, SAT – Flores de Curacaví en una superficie total de 2 ha, con una media de 0,2 ha/ predio, realizándolo en invernadero frío. En los meses de marzo a abril, 2013, se observó síntomas de nodulaciones en raíces de las variedades Capri Blue Picoti (bicolor), Deep Blue, Magic White, Super Magic Champagn, causando reducción de la calidad de las varas (menor altura de la vara, clorosis foliar y reducción del tamaño de la flor) con incidencia de 32, 18, 15, 20 % por variedad respectivamente. En la literatura nacional, en relación a nematodos formadores de nódulos radicales como Meloidogyne spp no había información para Lisianthus (Eustoma grandiflorum), en Chile, no así en Italia donde han sido reportados. Con el propósito de verificar e identificar la(s) especies del nematodo de la nodulaciones en raíces de Lisianthus, se muestreo 5 plantas completas de cada variedad con nódulos y necrosis radicular y además 500 gr. suelo de la rizósfera infectado por variedad. El análisis y diagnóstico se realizó por especialistas del Laboratorio Agrícola del SAG de la Región de Valparaíso, mediante el método de Baermann y características taxonómicas morfométricas, logrando determinar el género y especie(s) del nematodo Meloidogyne incognita y M. arenaria. Esta determinación se encuentra en proceso de confirmación mediante la técnica molecular PCR (Reacción en cadena de la Polimerasa) en el Laboratorio del SAG, Lo Aguirre, Región Metropolitana. Paralelamente se sembró segmentos de raíces con síntomas de necrosis, en medio PDA acidificado, incubados durante 7 días a 22°C, determinándose el agente fungoso Fusarium solani. La determinación de Meloidogyne spp, en raíces de Lisianthus es el primer reporte en el país de este agente causal para este cultivo.

Primera asociación de Cercospora sp. con manchas foliares en cultivo de Limonium sinuatum ( L.) Mill, de productores Prodesal Quillota, Región de Valparaíso

1 Arancibia, R.; 2 Palma, A.; 3 Lefno, N. 1Consultora Cifra Ltda., La Cruz, región de Valparaíso 2 Laboratorio de análisis de Valparaíso, Servicio Agrícola y Ganadero, región de Valparaíso 3 Prodesal- Quillota E-Mail: rosa.arancibia@cifra.cl

El Limonium o Statice, es una planta ornamental que se cultiva al aire libre y en invernadero frío, como flor de corte de uso en fresco y seco, de colores blanco, azul, rosado, amarillo. En cultivos de pequeños productores (7) de Prodesal-Quillota, con superficies promedio, de 0,25 ha/predio. Durante la temporada 2013 aparecieron manchas pequeñas, circulares y con un halo rojizo a nivel foliar. En plantas afectadas la producción se reducía a 10 a 14 varas disminuyendo los ingresos de los pequeños productores. Con el propósito de identificar él o los agentes causales asociados con síntomas de manchas foliares y desecación en Limonium, se realizó un muestreo de plantas con manchas foliares circulares de 3 a 6 mm de diámetro, de color café-gris con halo anaranjado a rojizo. En el análisis con lupa estereoscópica (20X), se observó conidióforos en fascículos pigmentados de color café-oliváceo claro que al microscopio (40X), resultaron ser tabicados, no ramificados, sinuosos, con una media de 58 µm de largo x 4,6 µm de ancho; desde donde nacen conidias hialinas, lisas, multiseptadas, rectas a curvadas, subagudas en el ápice y subtruncada en la base, de 97 µm de longitud x 3,4 µm de ancho, en promedio. Estas características taxonómicas se ajustan a las descritas para el género Cercospora sp. afectando a Limonium y otros miembros de la familia Plumbagináceae. Adicionalmente en algunas plantas con síntomas de atizonamiento y manchas foliares se identificó Botrytis cinerea Pers. y Alternaria sp. Se concluye que las pequeñas manchas circulares con halo rojizo están asociadas a Cercospora sp, siendo esta la primera descripción de este género para éste cultivo ornamental en el país.

Primera detección en Chile de Beet pseudoyellows virus (BPYV) en plantas de pepino (Cucumis sativus L.) variedades Alcazar y Pointiac

1Cabrera, M.; 2 Arancibia, R.; 2 Allendes, H. 1 Laboratorio de Virología Agrícola, Servicio Agrícola y Ganadero Región Metropolitana 2Consultora Allendes, Quillota E-Mail: arancibia.carvajal.rosa@gmail.com

En noviembre 2012 y abril 2013, en las localidades de San Pedro y Santa Olivia de Quillota (Región de Valparaíso), diez de doce predios (0,25 ha promedio) de pepino de ensalada en invernadero frío, han presentado síntomas de mosaico y amarillez foliar intervenal parcial o total, con una reducción del 50% del periodo de cosecha. Los síntomas se han manifestado en el 50 hasta el 75% de plantas, dependiendo del predio objeto de la visita. Muestras de plantas con síntomas fueron sometidas a pruebas serológicas ELISA, para la detección de Squash mosaic virus, Cucumber mosaic virus y Alfalfa mosaic virus. Los resultados de las pruebas ELISA, fueron negativos. Sin embargo, los síntomas observados recordaban también a aquellos causados por virus pertenecientes al género Crinivirus (Familia Closteroviridae), por lo que se decidió analizar muestras mediante la técnica de Reacción en Cadena de la Polimerasa de Transcriptasa Inversa (RT-PCR), utilizando las parejas de partidores 410L/410U y 172/175 para la detección específica de Cucumber yellow stunt disorder virus (CYSDV) y Beet pseudoyellows virus (BPYV), respectivamente. Como resultado se obtuvieron productos de amplificación de 780 bp solo con los partidores específicos para BPYV. Estos amplicones fueron secuenciados y luego analizados mediante la herramienta BLAST del NCBI, obteniéndose una alta identidad con el virus Cucumber yellow virus (CuYV) el cual corresponde a una raza de BPYV. Por lo tanto se concluye que esta sería la primera identificación de BPYV en pepino de ensalada en Chile.

Detección, cuantificación y viabilidad de Sclerotium cepivorum en suelos infectados, cultivados con ajo (Allium sativum L.), de pequeños productores Prodesal - Llay Llay, V región

1 Arancibia, R.; 3Undurraga, J.; 2 Palma, A.; 1 Barrueto, L. P.; 1Cisternas, A. 1Consultora Cifra 2 Laboratorio de análisis de Valparaíso, Servicio Agrícola y Ganadero, V región 3 Prodesal - Llay- Llay, V región E-Mail: rosa.arancibia@cifra.cl

El cultivo del ajo en las últimas 3 temporadas ha presentado pérdidas crecientes de bulbos por pudrición blanca, cuyo agente causal es Sclerotium cepivorum Berk. Esté patógeno produce esclerocios de 2 a 4 mm de diámetro en promedio, que sobreviven en el suelo por años, según literatura. Con el propósito de detectar, cuantificar y determinar la viabilidad de esclerocios de S. cepivorum en suelos infectados, cultivados con ajo tipo chino y rosado, se realizó un muestreo de suelo en tres predios un mes antes de la siembra de ajo. Se recolectó una muestra de 2 Kg de suelo por predio, a partir de los primeros 8 cm de profundidad. Para analizar la presencia y viabiliad de los esclerocios se aplicó la metodología de Yong-Ki Kim et al, 2004; Davis, Hao; Romberg, Nuñez y Smith, 2007. Mediante el uso de tamices de 500 y 250 micras se obtuvo una fracción de suelo que se trató con hipoclorito de sodio al 1%. Los esclerocios se detectaron y recolectaron, mediante el uso de una lupa estereoscópica (10 a 40 X). Luego de determinó su viabilidad cultivándolos en medio agar papa dextrosa acidificado, con incubación a 22°C durante 7 días. Se obtuvo 32 esclerocios/500 g de suelo en promedio por predio, de los cuales un 28% fueron viables (9 esclerocios) y un 72% fueron no viables, lo que se encontraban colonizados por Fusarium spp., Mucor sp. y Aspergillus spp.

Susceptibilidad de cultivares de frutilla a la pudrición de la corona y raíces causada por Macrophomina phaseolina

2Urcola, L.; 2 Sánchez, S.; 1Henríquez, J.; 2Gambardella, M. 1 Facultad de Ciencias Agronómicas, Universidad de Chile, Santiago, Chile 2 Facultad de Agronomía e Ingeniería Forestal, Pontificia Universidad Católica de Chile, Santiago, Chile E-Mail: svsanchez@uc.cl

En los últimos años se ha detectado una alta incidencia de la pudrición de la corona y raíces de la frutilla, causada por Macrophomina phaseolina, en la zona central de Chile. La principal estrategia de control de esta enfermedad es la aplicación de fumigantes en pre-transplante. Frente a la necesidad de disminuir las aplicaciones de agroquímicos, el objetivo de este trabajo fue estudiar la susceptibilidad de ocho cultivares de frutilla a M. phaseolina. Plantas de frutilla de los cultivares Amiga, Camarosa, Florida Elyana, Florida Festival, Florida Fortuna, Fontanilla, Naiad y Siba, fueron propagadas mediante estolones. Las plantas fueron establecidas en turba con perlita (2:1), inoculada con semillas de avena infectadas con el aislado Mp21.A de M. phaseolina, y puestas en macetas (1 L). El diseño experimental fue completamente al azar, la unidad experimental correspondió a una planta de frutilla, y se realizaron 18 repeticiones por tratamiento. Se evaluó la sintomatología de la parte aérea de las plantas durante 10 semanas, determinándose la curva de progreso de la enfermedad. Al término del ensayo se evaluó el grado de pudrición de la corona causada por M. phaseolina, se realizaron aislamientos corroborando o descartando la presencia del patógeno, además se determinó el peso seco de las plantas. Los cultivares presentaron diferentes comportamientos ante la infección por el fitopatógeno en el tiempo, los primeros síntomas en la parte aérea de las plantas se detectaron dos semanas después del trasplante. Al término del ensayo se observaron tres grupos con diferentes grados de susceptibilidad, Florida Fortuna y Siba presentaron una mayor susceptibilidad, mientras que Florida Elyana, Fontanilla, Naiad y Camarosa presentaron una susceptibilidad media. Amiga y Florida Festival fueron los cultivares que mostraron una menor susceptibilidad a la pudrición de la corona y raíces causada por M. phaseolina.

Detección molecular de Grapevine leafroll-associated virus 1, 2 y 3 en plantas cv. Cabernet Sauvignon de un viñedo de la zona central de Chile

1Cáceres, M.; 2Mujica, V.; 3 Sandoval, C. 1 Facultad de Ciencias Agrarias, Escuela de Agronomía, Universidad de Talca, Talca, Chile 2 Investigador Ajunto, Protección Vegetal, Instituto de Investigaciones Agropecuarias 3 Fitopatólogo, Antufen Seeds Ltda., Pichidegua, VI Región, Chile E-Mail: mcaceres@utalca.cl

El enrollamiento de la hoja de la vid (Vitis vinifera L.) causada por diferentes especies de virus asociadas a esta patología, es una de las enfermedades de mayor importancia a nivel mundial en esta especie. Al estar los patógenos causantes de esta enfermedad restringidos al tejido del floema, su distribución en la planta no es homogénea, lo que dificulta su detección. En la presente investigación se ha estudiado la presencia de tres virus del complejo enrollamiento de la hoja de la vid (GLRaV 1, GLRaV 2 y GLRaV 3) en un viñedo de la zona central de Chile plantado con el cv. Cabernet Sauvignon. Se recolectaron 100 muestras y se analizaron a través de dos métodos de detección (DAS ELISA y RT PCR). Con la primera técnica el 2% resultó positivo para GLRaV 1, solo el 1% para GLRaV 2 y el 10% para GLRaV 3. Por otra parte con la técnica RT PCR el 18% de plantas resultaron positivas para GLRaV1, el 10% para GLRaV 2 y el 28% para GLRaV 3. Realizando un análisis comparativo entre los dos métodos con la prueba estadística “Kappa”, sólo se observó concordancia para las dos técnicas en el caso de GLRaV 3. Los resultados obtenidos también muestran una mayor sensibilidad de RT PCR respecto a DAS ELISA, en la detección de los tres virus.

Susceptibilidad de cultivares de vid (Vitis vinifera L.) al brazo muerto producido por Diplodia mutila (Fr.) Mont.

Ramírez, M.; Montealegre, J.; Riquelme, D. Facultad de Ciencias Agronómicas, Universidad de Chile, Santiago, Chile E-Mail: jmonteal@uchile.cl

Durante la última década, la frecuencia de síntomas debido al ataque de hongos de la madera de la vid ha aumentado significativamente en todo el mundo. Especies fungosas de la familia Botryosphaeriaceae provocan la muerte parcial de la planta, disminuyendo la productividad y la rentabilidad del cultivo. En Chile, una de las especies presentes es Diplodia mutila, asociada principalmente a la enfermedad del brazo muerto de la vid. El objetivo de esta investigación fue evaluar la susceptibilidad a D. mutila de cultivares de vid vinífera (Cabernet Franc, Malbec, Merlot, Sauvignon Blanc y Syrah) y de mesa (Crimson Seedless, Flame Seedless, Red Globe y Thompson Seedless). Para ello, se realizó un ensayo “in vivo” en estacas de un año, las cuales fueron inoculadas con discos de agar con micelio de D. mutila, en el sector medio del entrenudo mediante la realización de una herida. Las estacas fueron mantenidas en oscuridad, a una humedad relativa del 95% en cámara de crecimiento, con una temperatura de 25°C, considerando 10 repeticiones por cultivar, por 4 a 6 semanas. Al término del período de incubación, se evaluó la longitud de la lesión necrótica a partir de la zona inoculada. Al comparar separadamente la susceptibilidad dentro de los cultivares viníferos o de mesa investigados, no se observaron diferencias. Sin embargo; al comparar entre todos los cultivares evaluados, se observó que el avance de la lesión fue mayor en los cultivares viníferos, determinándose que los cultivares Malbec y Syrah fueron los más susceptibles.

Hongos patógenos asociados a semillas de Nothofagus spp.

Balocchi, F.; Aguilar, F.; Barría, V.; Sanfuentes, E. Facultad de Ciencias Forestales, Universidad de Concepción, Concepción, Chile E-Mail: esanfuen@udec.cl

Las especies de Nothofagus en Chile, entre las que se encuentran el Raulí (Nothofagus alpina), el Roble (N. obliqua), el Ruil (N. alessandrii) y el Coigüe (N. dombeyi), poseen un importante potencial productivo y de conservación. Estas especies presentan una baja capacidad germinativa cada ciertos años y en procedencias especificas, pudiendo causar problemas en su propagación. Se desconoce completamente rol que puedan tener hongos patógenos en estas pérdidas. Por esta razón se realizó un estudio con el objetivo de detectar hongos asociados a las semillas de N. alpina, N. alessandrii, N. dombeyi, N. obliqua y determinar su patogenicidad. Para esto se utilizaron 8 lotes de semillas de procedencias ubicadas entre la Región del Maule y la Región de la Araucanía. Las semillas fueron desinfestadas superficialmente y se realizaron aislamientos en medio de cultivo agar papa dextrosa (APD) y las pruebas de patogenicidad consistieron en colocar semillas de N. alpina, N. dombeyi y N. obliqua en colonias de cada hongo, las que estaban creciendo en APD y luego de cuatro días sembradas en arena estéril. En total fueron aisladas 67 cepas de hongos y 42 fueron utilizadas para inocular las semillas, evaluándose emergencia y mortalidad de plántulas. Al finalizar el ensayo cuatro cepas redujeron significativamente la emergencia de plántulas de N. alpina y N. obliqua, las que fueron identificadas taxonómica y molecularmente como Diaporthe australafricana, Truncatella angustata, Fusarium lateritium y Alternaria sp. Los mayores efectos fueron causados por D. australafricana (30%) y T. angustata (34.4%), que en Chile habían sido reportados produciendo cancros en especies de frutales. No se encontraron otros reportes de estos agentes asociados a especies de Nothofagus o a semillas de especies nativas chilenas. Convenio de Investigación con Centro de Semillas, CONAF (Región del Bíobío.)

Supresividad a Pythium sp. de tres suelos de bosque nativo en plantas de tomate

Millas, P. Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación Quilamapu, Chillán, Chile E-Mail: pmillas@inia.cl

Numerosos cultivos de trasplante son afectados por caída de plántulas o damping-off causado por Pythium sp., este patógeno es comúnmente controlado con fungicidas en almaciguera; sin embargo, la creciente restricción al uso de agroquímicos hace necesaria la búsqueda de nuevas alternativas de control. La actividad microbiana del suelo ha sido correlacionada con la supresividad que presentan algunos suelos a Pythium sp. Esta actividad es más alta en suelos con altos contenidos de materia orgánica de reciente incorporación como los suelos de bosque nativo. Para determinar la capacidad supresiva a Pythium sp., de tres suelos de bosque nativo, se colectaron dos suelos provenientes de la precordillera de la octava Región y uno del Parque Oncol en Valdivia. Cada uno de los suelos fueron puestos en macetas de 500 mL y se inocularon con Pythium sp. agregando 0,1 % peso/volumen de inóculo preparado en una mezcla de suelo y papa rallada, además se contó con controles de vermiculita: suelo estéril (1:1) con y sin inocular. Se sembraron 3 semillas por maceta de tomate cv. Cal ace y se regó cada 2 días en invernadero. Veinticinco días post-siembra, se evaluó la severidad de la enfermedad según una escala de 1 a 4. Se utilizó el diseño completamente al azar y se aplicó un ANOVA. También se determinó la actividad microbiana total del suelo a través del método de FDA. La severidad de Pythium sp. varió entre 2,10 ± 0,2 y 1,63 ± 0,2 para el control con y sin inóculo, respectivamente. Los dos suelos provenientes de la octava Región presentaron severidades que no difirieron significativamente del control sin inóculo, coincidiendo con los valores más altos de FDA. Se concluye que suelos de bosque nativo con alta actividad microbiana presentan efecto supresivo frente a damping-off causado por Pythium sp. en plántulas de tomate.

Caracterización serológica de aislados del Virus Y de la papa (PVY) de las Regiones de La Araucanía, Los Ríos y Los Lagos

1Montalva, C.; 2Muñoz, M.; 3Gutierrez, M.; 2Rosales, M.; 1Carrillo, R.; 4 Acuña, I. 1 Instituto de Producción y Sanidad Vegetal, Facultad de Ciencias Agrarias, Universidad Austral de Chile. 2Departamento de Ciencias Vegetales, Facultad de Agronomía e Ingeniería Forestal, Pontificia Universidad Católica de Chile 3 Servicio Agrícola y Ganadero (SAG), Laboratorio Regional Osorno 4 Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación Remehue E-Mail: camilo.montalva@alumnos.uach.cl

El Virus Y de la papa (PVY) se considera el virus más perjudicial en el cultivo de papa (Solanum tuberosum L.) en todo el mundo. Existen diversas variantes o razas de PVY, las que pueden ser diferenciadas por los síntomas que provocan, propiedades serológicas y variaciones en regiones genómicas del virus. El objetivo del presente estudio fue caracterizar serológicamente las razas de PVY presentes en las Regiones de La Araucanía, Los Ríos y Los Lagos. Entre los años 2011 y 2013 se colectó un total de 379 muestras de papa, las cuales fueron sometidas a DAS-ELISA y RT-PCR, obteniendo un total de 112 muestras (29,55%) positivas a PVY. Estas muestras positivas a PVY fueron liofilizadas e identificadas a nivel de razas mediante RT-PCR. Posteriormente, fueron analizadas serológicamente utilizando anticuerpos monoclonales que detectan PVYO y PVYC (AGDIA-Mab 2) y el grupo PVYN (AGDIA-MAb 1F5 y NEOGEN-N). Un total de 76 aislados de PVY (67,85%) concordaron entre los resultados del análisis molecular y serológico, de los cuales 57 aislados correspondieron a la raza PVYNTN; 18 a la raza PVYO ; un aislado a la raza PVYN y un aislado a la raza recombinante PVYN:O. Para los casos en que los análisis moleculares y serológicos no concordaron, siete aislados que molecularmente pertenecieron a las razas PVYNTN y PVYO no fueron detectados por ningún anticuerpo monoclonal, posiblemente por mutaciones en los determinantes antigénicos de los aislados. Por otra parte, un aislado perteneciente molecularmente a la raza PVYNTN y uno a la raza PVYN presentaron reacciones positivas con los tres anticuerpos monoclonales, los que presumiblemente corresponderían a aislados ancestrales de PVY. A futuro se seleccionará un aislado representante de cada una las razas identificadas para su estudio biológico y de eficiencia de transmisión por Myzus persicae (Sulzer). Fuente de financiamiento: FIA PYT-2011-0065.

Caracterización molecular de razas del Virus S de la papa identificadas en muestras provenientes de las regiones de Los Ríos y Los Lagos

1 Vargas, E.; 2Gutiérrez, M.; 3 Acuña, I.; 1Rosales, M. 1Departamento de Ciencias Vegetales, Facultad de Agronomía e Ingeniería Forestal, Pontificia Universidad Católica de Chile 2 Servicio Agrícola y Ganadero (SAG), Laboratorio Regional Osorno 3 Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación Remehue E-Mail: irosalesv@uc.cl

El Virus S de la papa (PVS) es uno de los virus con mayor prevalencia en cultivos de papa (Solanum tuberosum L.) en el mundo, al que se le atribuyen reducciones de rendimiento de hasta un 20%, a pesar de que en muchos casos provoca infecciones asintomáticas. PVS presenta un genoma de RNA hebra simple, con 6 marcos de lectura abiertos y se le reconocen dos razas, PVSO (ordinaria) y PVSA (andina). PVSA es capaz de inducir: infección sistémica en plantas de Chenopodium quinoa; síntomas más evidentes en papa. Además, la transmisión por áfidos es más eficiente si se compara con PVSO . Estas dos razas también pueden ser diferenciadas genéticamente, debido a variaciones en las secuencias de nucleótidos o de aminoácidos de la proteína 7K, proteína de la cubierta (CP) y la proteína de unión a nucleótidos (11K). Prospecciones realizadas en el año 2012 indican que la prevalencia de PVS alcanzó un 63% en muestras colectadas en la Región Los Rios y Los Lagos. En este trabajo se presenta la caracterización molecular de razas de PVS correspondientes 26 aislados provenientes de las regiones antes mencionadas, utilizando los dominios de los genes que codifican para la CP (880 bp). Luego de amplificar y secuenciar este gen, se realizó un alineamiento múltiple mediante Clustal W y un análisis fenético utilizando el método UPGMA (Geneious 6.0.5). El árbol construido presentó dos agrupamientos, el primer clado agrupó todas las secuencias de referencia de PVSA junto a 2 aislamientos chilenos, mientras que el segundo clado estuvo conformado exclusivamente por secuencias de referencia de PVSO junto a los restantes 24 aislados chilenos. La mayor prevalencia de las razas PVSO en las muestras analizadas, refuerzan la importancia del uso de material de siembra libre de este virus, para reducir sustancialmente la incidencia de este agente en el cultivo de la papa en Chile.

Determinación de Plantago asiatica mosaic virus (PlMV) en plantas de Lilium (Lillium sp.) en las Regiones de Los Ríos y de Los Lagos

Cabrera, M.; Pizarro, M.; Vergara, C. Laboratorio de Virología Agrícola, Servicio Agrícola y Ganadero, Santiago, Chile E-Mail: marcelo.cabrera@sag.gob.cl

La exportación de bulbos de Lilium (Lilium sp.) a mercados como el japonés, está restringida en forma muy importante por el cumplimiento de los requisitos fitosanitarios que solicita el país de destino. En este contexto el Servicio Agrícola y Ganadero recibió una solicitud de certificar la presencia de Plantago asiatica mosaic virus (PlMV) en bulbos, virus del cual no se disponía de información con respecto a su presencia en el país. Por este motivo se decidió realizar una prospección de este virus en plantaciones de Lilium en las regiones de Los Ríos y de Los Lagos. Se colectaron plantas de Lilium asintomáticas y con síntomas similares a los descritos para este virus. Como técnica de diagnóstico se decidió realizar RT-PCR utilizando partidores diseñados en una zona conservada del gen codificante de la proteína de capside de este virus. La extracción de ácido nucleico total se realizó a través del método de captura con sílica. El cDNA se obtuvo utilizando partidores hexanucleótidos que funcionan al azar y los productos de PCR fueron evaluados en electroforesis de agarosa. Como resultado se obtuvieron productos de PCR del tamaño esperado en cuatro predios de los muestreados, uno correspondientes a la región de Los Lagos y tres de la región de Los Rios. Se realizó un análisis de las secuencias obtenidas a través de BLAST, obteniéndose 88% de identidad con las secuencias de este virus publicadas en el NCBI, por lo cual esto correspondería a la primera determinación de PlMV en Chile.

Determinación molecular de Botryosphaeria obtusa (Schwein.) Shoemaker y Diplodia seriata asociado a la enfermedad muerte de brazos en Kiwi, Región del Maule, Chile

Castilla, A.; Cáceres, M.; Núñez, F.; Méndez, R.; Muñoz, C.; Lolas, M. Universidad de Talca, Laboratorio de Fitopatología Frutal, Facultad de Ciencias Agrarias E-Mail: acastilla@utalca.cl

La muerte de brazos es la principal patología que afecta al kiwi en Chile. El agente causal no se ha identificado con exactitud y se postula la presencia de un síndrome generado por un complejo de hongos donde participarían especies de la familia Botryosphaeriaceae. Desde maderas provenientes de plantas sintomáticas y trampas de esporas (portaobjetos con vaselina) recolectadas en huertos de la Región del Maule, se aislaron cultivos fúngicos con morfología atribuible a especies de Botryosphaeriaceae. Una vez en medio APD se realizó la identificación molecular y morfológica, respectivamente. Para la identificación molecular se extrajo ADN desde el micelio del hongo, se amplificó por PCR con los primers ITS1-ITS4, EF728F-EF986R y Bt2a-Bt2b; y posteriormente se secuenció la región amplificada en cada caso. Para el análisis molecular se utilizaron tres regiones del genoma: ITS, EF y β-tubulina. La identificación morfológica se realizó a través de claves. Paralelamente se realizaron pruebas de patogenicidad para corroborar la acción degradadora del hongo en cada caso; para esto se utilizaron frutos y ramillas de kiwi, y frutos de manzana. En la investigación se logró establecer que los cultivos aislados corresponden a Botryosphaeria obtusa (Schwein.) Shoemaker y Diplodia seriata, su fase anamorfa, evidenciando ambos hongos ser patogénicos en las evaluaciones realizadas.

Identificación molecular de Bjerkandera adusta (Willd.) P. Karst asociado a la enfermedad de la madera en Kiwi, Región del Maule, Chile

Castilla, A.; Valdés, C.; Muñoz, C.; Lolas, M. Universidad de Talca, Laboratorio de Fitopatología Frutal, Facultad de Ciencias Agrarias E-Mail: acastilla@utalca.cl (Becaria CONICYT)

Bjerkandera adusta es un hongo asociado a enfermedades de la madera en kiwi, especialmente a la ´muerte de brazos´, reportada en las principales zonas productoras de la Región del Maule. Corresponde a un basidiomycete que causa una pudrición blanca en muchas angiospermas y gimnospermas, la sintomatología comienza por el desarrollo de clorosis, deformación y necrosis foliar, y posteriormente una rápida muerte y descomposición de madera. En campo forma abundantes basidiocarpos adosados a la superficie de plantas, la superficies de estas estructuras es ligeramente aterciopelada, varían de coloración blanquecina a tonos bronce o gris y el envés es de color gris. Se desconoce la participación de este hongo en la enfermedad ´muerte de brazos´, sin embargo por su acción degradadora de madera se asocia a huertos de kiwi sintomáticos. Desde trampas de esporas (portaobjetos con vaselina) recolectadas en huertos de la Región del Maule, se aislaron cultivos fúngicos con morfología atribuible a la especie y se purificaron en medio de cultivo PDA. Para realizar la identificación morfológica se utilizaron claves taxonómicas. Para la identificación molecular se utilizaron tres regiones del genoma del hongo: ITS, EF y β-tubulina. Con el mismo fin se extrajo ADN genómico proveniente de micelio, la amplificación se realizó con los primers ITS1-ITS4, EF728F-EF986R y Bt2a-Bt2b, y posteriormente se secuenció la región amplificada en cada caso. Actualmente se están realizando las pruebas de patogenicidad en frutos y ramillas de kiwi, y frutos de manzana. La investigación logró establecer que los cultivos aislados desde los huertos muestreados corresponden a Bjerkandera adusta (Willd.) P. Karst.

Actividad antifúngica de propóleos y extractos vegetales chilenos sobre cepas de Botrytis cinerea

1 Balboa, N.; 2 Lillo, A.; 1 Parada, M.; 3 Salazar, L.; 2,3Alvear, M. 1 Facultad de Ciencias Agropecuarias y Forestales. Universidad de La Frontera, Temuco, Chile 2Departamento de Ciencias Químicas y Recursos Naturales. Facultad de Ingeniería, Ciencias y Administración. Universidad de La Frontera, Temuco, Chile. 3Núcleo de Desarrollo Científico-Tecnológico en Biorecursos (BIOREN – UFRO) E- Mail: n.balboa01@ufromail.cl, marysol.alvear@ufrontera.cl

En Chile, Botrytis cinerea causa importantes pérdidas en el sector hortofrutícola, principalmente en berries y uvas. Por este motivo, es de gran importancia investigar nuevos antifúngicos a base de productos naturales que controlen a este fitopatógeno El objetivo de este estudio fue evaluar la actividad antifúngica de mezclas de extractos etanólicos de propóleos (EEP) con extractos vegetales y extractos etanólicos vegetales puros (EEVP) de Luma apiculata y Podocarpus salignus, sobre cepas de B. cinerea (aisladas de frutilla, cereza y frambuesa). Se utilizaron EEP y EEVP, a los que se les cuantificó polifenoles totales por el método de Folin-Ciocalteau y flavonoides por el método del AlCl3. Además, se identificaron algunos de los componentes de EEP y EEVP mediante cromatografía líquida de alta resolución (HPLC). Finalmente se evaluó la actividad antifúngica in vitro, donde se embebieron 5µl de las muestras a discos de 6 mm en medio Agar-Papa-Dextrosa y se comparó con la actividad antifúngica del control positivo (benzimidazol) y control negativo (etanol), todos estos análisis se realizaron en triplicado. Los resultados fueron evaluados mediante análisis de varianza (ANOVA de una vía) y la comparación entre las medias se llevaron a cabo usando el test de comparación múltiple de Tukey, con un nivel de significancia de 5% (P≤ 0,05). El EEP de la región del Bio-Bío y EEVP de Luma apiculata, presentaron la mayor concentración de compuestos polifenólicos y flavonoides. Por HPLC se detectaron 44 compuestos diferentes en EEP, de los cuales destacan por su alta concentración, pinocembrina, apigenina, quercetina, galangina y fenil éster del ácido cafeico. Las distintas cepas de B. cinerea presentaron diferente respuesta a los productos evaluados. Para las cepas de frutilla y frambuesa el mejor resultado se obtuvo con la mezcla de EEP y Luma apiculata. Mientras que para la cepa de cereza correspondió al extracto de Luma apiculata. Agradecimientos: Los autores agradecen a los Proyectos FONDEF D051-10021 y FONDEF CA12i10134 de CONICYT.

Evaluación de la eficacia de Bacillus subtilis en el control de Fusariosis en tomate

Torres, C.; Besoain, X. Facultad de Agronomía, Pontificia Universidad Católica de Valparaíso, Quillota, Chile E-Mail: xbesoain@ucv.cl

La fusariosis vascular o podredumbre del cuello del tomate (Solanum lycopersycum L.) causada por Fusarium oxysporum (Schltdl.) es una enfermedad de importancia mundial descrita en 32 países (Jones, 1999), incluyendo a Chile. El control biológico se presenta como una alternativa para esta enfermedad, buscando restringir su desarrollo con una mínima interferencia con el medio ambiente. Considerando la importancia de evaluar nuevos productos, como lo son los productos biológicos, para el control de esta enfermedad en tomate, es que esta investigación tuvo como objetivo, evaluar la eficacia de tres tratamientos preventivos de Bacillus subtilis (T2: 3 L/ha, T3: 5 L/ha y T4: 6 L/ha), para el control de Fusariosis del tomate causada por Fusarium oxysporum, en comparación a un tratamiento estándar (T5: Goldazim 1m/m2 ) y un tratamiento testigo (T1). La eficacia de la bacteria en el control de la enfermedad fue evaluada con dos aplicaciones con 21 días de intervalo sobre tratamientos con 8 repeticiones distribuidas en bloques completamente al azar. La inoculación se realizó 24 horas después de la primera aplicación a una concentración de 3,3 x 105 propágulos/ml, adicionando 100 ml de agua destilada estéril (ADE) a cada maceta. Las evaluaciones se hicieron cada 21 días, después de cada aplicación estimando incidencia (%) y severidad (%). Además, de altura de plantas (cm), diámetro del tallo (mm) y peso fresco aéreo (g) y de raíces (g) en la evaluación final. El tratamiento 4 (7 L/ha) fue el más eficaz en disminuir el daño causado por Fusarium oxysporum en plantas de tomate desarrolladas bajo condiciones de invernadero, con un porcentaje de severidad igual a cero. Los tratamientos con dosis de 3 l/ha y 5 l/ha, al igual que el fungicida Goldazim (Carbendazima), disminuyen el daño de la enfermedad, pero en un menor rango. No obstante, en las variables altura de planta, peso total y diámetro del tallo, no se observaron diferencias significativas para ninguno de los tratamientos. Financiamiento: Bayer Cropscience.

Prospección de Olpidium sp. en suelos y sustratos cultivados con melón (Cucumis melo L.) y tomate (Solanum lycopersicum L.), de la región Metropolitana

Sepúlveda, J.; Valenzuela, C.; Wong, W. Facultad de Ciencias Agrarias y Forestales, Universidad Iberoamericana de Ciencias y Tecnología, Santiago de Chile E Mail: wwong@uibero.cl

El melón y el tomate son cultivos de gran importancia en Chile, fundamentalmente en la región Metropolitana. Estos cultivos se ven afectados por numerosas enfermedades dentro de las cuales se encuentran los virus. El virus de las manchas necróticas del melón (Melon necrotic spot virus, MNSV), y su hongo transmisor Olpidium bornovanus (Sahtiy.) Karling, fueron ya detectados en la comuna de Melipilla. Por otro lado, en los principales países productores de tomate se ha estado presentando un síndrome denominado “colapso”. Este se atribuye a la presencia de aislados agresivos del virus del mosaico del pepino dulce (Pepino mosaic virus, PepMV), en combinación con la presencia en las raíces, del hongo O. brassicae (Woronin) P.A. Dang. Estos hongos pueden sobrevivir durante más de 15 años en suelo seco mediante sus esporas de resistencia. Debido a que los virus no tienen control curativo es necesario actuar directamente sobre los hongos vectores. El objetivo de este trabajo fue realizar una prospección de O. bornovanus y de O. brassicae en suelos y sustratos destinados a los cultivos de melón y tomate, respectivamente, de la región Metropolitana. Las muestras de suelo y sustrato se colocaron en contenedores plásticos y para detectar los hongos se sembraron semillas de melón y de tomate que fueron utilizadas como plantas trampa. Treinta días después de la germinación, las plantas fueron llevadas al laboratorio donde se evaluó la presencia o ausencia de las esporas de resistencia de ambos patógenos en las raíces. En el caso de las muestras de suelo, O. brassicae, se encontró solamente en las comunas de Paine y Colina. O. bornovanus se detectó en al menos una localidad de todas las comunas prospectadas. Las muestras de sustratos, donde se encontró O. brassicae y O. bornovanus, correspondieron principalmente a los compuestos por tierra de hojas y turba reciclada.

Contenido de polifenoles totales y capacidad antioxidante en materiales genéticos de Acca selowiana (Berg) Burret.

1 Silveira, A.C.; 1 Záccari, F.; 2Rivas, M. 1 Poscosecha de Frutas y Hortalizas. Departamento de Producción Vegetal. Facultad de Agronomía, Universidad de la República. Montevideo, Uruguay 2 Fitotecnia, Departamento de Biología Vegetal, Facultad de Agronomía, Universidad de la República E-Mail: acsilver@fagro.edu.uy

El Guayabo del País, Acca sellowiana (Berg) Burret, es una especie nativa que ha despertado interés por su característico sabor y aroma y por su composición nutricional. En este trabajo se evaluaron 10 materiales genéticos seleccionados por la Facultad de Agronomía e instalados en un predio comercial. Los frutos se cosecharon en tres estados de madurez (inmaduro, intermedio, maduro). Se determinó el contenido de polifenoles totales por el método de Singleton y Rossi y la actividad antioxidante por el método del radical 2, 2-Difenil-1-Picrylhydrazyl (DPPH). Los frutos inmaduros presentaron mayores contenidos de polifenoles, 493,61 mg equivalentes de ácido gálico (EAG) 100 g-1 PF. En el estado intermedio y el estado maduro los valores fueron de 442,23 mg EAG 100 g-1 PF y 341,69 respectivamente. En relación a los materiales genéticos, los clones 14 y 26 fueron superiores. Los frutos de estos clones en el estado inmaduro, alcanzaron valores de 821,63 y 963,15 mg EAG 100 g-1 , mientras que, en el estado intermedio presentaron 712,69 y 789,95 mg EAG 100 g-1 y en el estado maduro, 525,23 y 525,93 mg EAG 100 g-1 respectivamente. La actividad antioxidante de los frutos inmaduros fue mayor, con un valor de 480,11 mg ácido ascórbico (AA) 100 g-1 PF. Los valores de los estados de madurez medio y maduro fueron de 382 y 312,26 mg AA 100 g-1 PF, respectivamente. Los clones 23 y 26 mostraron la mayor actividad antioxidante siendo de 437,73 y 436,28 mg AA 100 g-1 PF para el estado medio y de 352,03 y 396,12 mg AA 100 g-1 PF para el estado maduro respectivamente. Los resultados obtenidos han permitido corroborar diferencias en estado de madurez y materiales genéticos que puede usarse en programas de selección y mejoramiento. Agradecimientos: Agencia Nacional de Investigación e Innovación (ANII), proyecto Mejoramiento genético participativo y desarrollo de productos innovadores del guayabo del país (Acca sellowiana) en la Quebrada de los Cuervos (Treinta y Tres)

Requerimiento de frío en peras (Pyrus communis L.) variedad Packham’s Triumph y su relación con la vida de postcosecha: efecto de la zona agroclimática y estado de madurez Acuña, P.; Granger, C.; Manriquez, D.

AgroFresh, Rohm and Haas Chile Limitada, Curicó, Chile.

En peras, al igual que en otros frutos climatéricos la hormona vegetal etileno coordina muchos de los procesos asociados a la maduración. Sin embargo, tanto la producción como la percepción de etileno en peras son afectadas por el requerimiento de frío, que corresponde a un período de tiempo en que los frutos deben permanecer expuestos a bajas temperaturas para que tanto la producción como la percepción de etileno se produzcan y los frutos logren madurar. El tiempo que la fruta debe estar expuesta a bajas temperaturas, depende de la variedad (“background” genético) y otros factores de pre-cosecha (zona agroclimática) y estado de madurez, entre otros. La hipótesis evaluada fue: que frutos de zonas más frías, a mismo estado de madurez, demoran menos tiempo en producir y percibir etileno en comparación con frutos de zonas cálidas. El objetivo fue caracterizar el requerimiento de frío para frutos provenientes de distintas zonas agroclimáticas y estados de madurez. Durante dos temporadas tres huertos de peras var. Packham’s Triumph de tres zonas agroclimáticas distintas fueron monitoreados en cuatro distintos estados de madurez cada uno, para estudiar el requerimiento de los frutos y conocer cuando se inicia la producción de etileno y que incidencias tiene esto en la vida de post-cosecha de los frutos así como el efecto de distintos manejos de post-cosecha. Es así como frutos provenientes de regiones con temperaturas más bajas tienden a producir etileno en menor tiempo de almacenamiento refrigerado, mientras que los frutos de zonas más cálidas demoran más tiempo en producir etileno. De este modo, aquellos frutos de zonas más frías tienden a tener una menor vida de post-cosecha comparada con frutos de zonas cálidas. v

Tizón floral causado por Sclerotinia sclerotiorum en frutales de carozo en Chile

Ferrada, E.; Latorre, B.; Díaz, G. Facultad de Agronomía e Ingeniería Forestal, Pontificia Universidad Católica de Chile, Santiago, Chile E-Mail: eeferrada@uc.cl

En 2012, tizón floral se observó en nectarino 'Sweet Artic' y 'Summer Brigth', ciruelo 'Larry Ann' y cerezo 'Brooks' y 'Royal Aurora' en huertos comerciales en el centro de Chile con una prevalencia o incidencia de 2 a 3%. Flores enfermas y aparentemente sanas se colocaron en cámara húmeda a 20°C por 5 días. Los pétalos necróticos se sembraron en agar papa dextrosa acidificado con 0,5 ml/L de ácido láctico 92% (APDA), por 5 días a 20°C, obteniendo colonias fungosas blanco algodonosas con esclerocios negros de forma esférica y ovoide de 2,5 a 4,2 x 2,8 a 5,3 mm (n = 60), identificadas como Sclerotinia sclerotiorum (Lib.) de Bary. Esta identificación se corroboró por análisis de la región ITS del rDNA. Los aislados identificados (GenBank Nos. KF148604-9), revelaron entre 99 y 100% de similitud con los aislados de referencia de S. sclerotiorum (EU082466 y JX307092). Aislamientos de S. sclerotiorum (n=4) fueron patogénicos en flores de cerezo 'Bing' y ciruelo 'Larry Ann' desarrollando una rápida necrosis en los pétalos hasta comprometer totalmente la flor. Los mismos aislamientos fueron patogénicos en frutos maduros (n=4) de nectarino 'Summer Bright, ciruela 'Larry Ann' y cereza 'Staccato', los que desarrollaron una pudrición blanda y acuosa, marrón claro, con un diámetro de lesión en cerezas de 2,0 a 11,3 mm, en ciruelas de 14,1 a 38,0 mm y nectarinos de 34,4 a 46,5 mm después de 3 días a 20°C, junto con presencia de un micelio blanco algodonoso superficial. Igual número de flores y frutos, heridos pero no inoculados, se mantuvieron sanos. S. sclerotiorum se reaisló desde flores y frutos inoculados artificialmente cumpliendo de este modo con los postulados de Koch. En conclusión, este trabajo demuestra la presencia de S. sclerotinia asociado al tizón floral de los frutales de carozo, normalmente atribuido solo a la acción de Monilia laxa.

Diversidad de Botrytis asociada a tizón floral en frutales de carozo en Chile

Ferrada, E.; Latorre, B. 1 Facultad de Agronomía e Ingeniería Forestal, Pontificia Universidad Católica de Chile, Santiago, Chile E-Mail: blatorre@uc.cl, eeferrada@uc.cl

El tizón floral de los frutales de carozo (Prunus spp.) ocurre cuando prevalecen ambientes húmedos y templados durante la floración. Bajo estas condiciones, se ha asociado la presencia de Botrytis cinerea a necrosis parcial o total de flores en ciruelos y durazneros de la zona central de Chile. En 2012, se obtuvieron 12 aislamientos identificados morfológicamente como B. cinerea. Estos aislamientos difieren en la capacidad de esporulación en APD, agar arveja y medio B de King. Este trabajo tuvo el propósito de caracterizar molecularmente los aislados de B. cinerea obtenidos. Estos aislamientos se caracterizaron molecularmente sobre la base del análisis de la región ITS del rDNA y del gen gliceraldehído 3 fosfatodeshidrogenasa (G3PDH) (5ATTGACATCGTCGCTGTCAACGA3 y 3’ACCCCACTCGTTGTCGTACCA5’). Los resultados obtenidos con ITS demostraron total (100%) similitud con las secuencias de aislados de referencia de B. cinerea obtenidas de GenBank. Sin embargo, según el análisis filogenético, empleando G3PDH, ocho aislados (Botrytis sp.1), originalmente identificados como B. cinerea, se agruparon en un conjunto claramente diferente al de B. cinerea. Todos los aislados fueron patogénicos en flores y frutos de ciruelo japonés (P. salicina). Los resultados obtenidos en este estudio, demuestran diversidad genética asociada a Botrytis en Prunus spp., situación detectable por análisis molecular del gen G3PDH. El análisis del gen ITS no permitió segregar los aislados de Botrytis. Todos los aislados identificados como Botrytis sp.1 correspondieron a aislados con escasa esporulación en APD, agar arveja y medio B de King.

Evaluación de la eficacia del fungicida en mezcla penthiopyrad + picoxystrobin en el control de Venturia del manzano en huertos de la Región del Maule, Chile

1Méndez, R.; 1 Lolas, M.; 2 Soto, S.; 1Muñoz, C.; 1Cáceres, M.; 3Rodriguez, J. 1Universidad de Talca, Facultad de Ciencias Agrarias, Laboratorio de Sanidad Vegetal 2 Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación La Platina 3Du Pont Chile S.A. E-Mail: rmendez@utalca.cl

Se evaluó la eficacia del fungicida en mezcla penthiopyrad + picoxystrobin en el control de Venturia del manzano (Venturia inaequalis) en la Región del Maule durante cinco temporadas, utilizando un huerto cv. Red Chief. En 2008-2009, 2,5; 3,3 y 5 ml i.a. /hl fueron aplicados cada 10 días, partiendo en fruto cuajado y con 3 aplicaciones en total. Los árboles testigos mostraron una incidencia de 64% de hojas con sarna, mientras que penthiopyrad + picoxystrobin presentó una incidencia entre 4,4 - 11,9%. En 2009-2010, se evaluó el fungicida en concentraciones de 3,3; 5; 6,7 y 8,3 ml i.a. /hl, realizando las aplicaciones en botón rosado, plena flor y fruto cuajado. El testigo mostró una incidencia de 54,4 y 7,3% de Venturia en hojas y frutos, respectivamente. Penthiopyrad + picoxystrobin presentó incidencias entre 0 - 1,3% en hojas y 0 - 0,5% en frutos. En 2010-2011, 1,7; 3,3; 5; 6,7; 8,3 y 10 ml i.a. /hl fueron aplicados en puntas verdes, plena flor y a condiciones de lluvia. Los árboles testigos presentaron incidencia de 66,3 y 21% en hojas y frutos, respectivamente. Los niveles de incidencia del fungicida fluctuaron entre 0 - 8,8% en hojas y 0 - 0,5% en frutos. En 2011-2012, 1,7; 3,3 y 5 ml i.a. /hl fueron aplicados cada 7 días a partir de puntas verdes, en total 5 aplicaciones. Los testigos presentaron una incidencia de 74,4 y 18,8% en hojas y frutos respectivamente, mientras que en los tratamientos la incidencia fluctuó entre 0 - 2,5% en hojas y 0 - 1,9% en frutos. Finalmente en 2012-2013, se evaluó el fungicida en dosis de 3,5 ml i.a. /hl, siendo aplicado en plena flor y fruto cuajado, en reemplazo de los productos utilizados por un huerto comercial cv. Royal Gala. Los testigos mostraron niveles de incidencia de 64 y 25,4% en hojas y frutos respectivamente. El fungicida presentó un 3,8% de incidencia en hojas y 2,5% en frutos. En conclusión, la mezcla fungicida penthiopyrad + picoxystrobin probó ser eficaz en el control de Venturia del manzano.

Resistencia al virus causante de la tristeza de los cítricos Citrus tristeza virus mediante silenciamiento génico post-transcripcional (SGPT)

1Madariaga-Villarroel, M.; 2Reyes, E.; 3 Besoain, X.; 2 Arce, P. 1 Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación La Platina, Santiago, Chile. 2 Facultad de Cs. Biológicas, Pontificia Universidad Católica de Chile, Santiago, Chile. 3 Facultad de Agronomía, Pontificia Universidad Católica de Valparaíso, Quillota, Chile E-Mail: mmadariaga@inia.cl

La “tristeza de los cítricos” causada por el virus Citrus tristeza virus (CTV), es sin duda alguna la enfermedad que ha causado mayor daño al cultivo de los cítricos. Evidencia de ello es la pérdida de más de 100 millones de árboles de naranjo dulce injertados sobre naranjo agrio, como también la disminución de la producción en plantas injertadas sobre Citrus macrophylla que es altamente sensible a la infección del virus. En Chile, la enfermedad se ha extendido por toda la zona citrícola nacional a excepción de la VII región. El mayor daño se ha determinado en la región norte, donde se han identificado aislados capaces de causar severo stem pitting lo que representa una amenaza para la citricultura nacional. CTV posee un genoma conformado por una simple hebra de RNA de sentido positivo de aproximadamente 20.000 pb, que está organizado en 12 marcos de lectura abiertos. Tres de ellos codifican para supresores del mecanismo del silenciamiento los que difieren en su modo de acción, impidiendo de este modo que la planta pueda defenderse frente a la infección viral. Este trabajo propone la generación de plantas de Citrus macrophylla resistentes o tolerantes a la enfermedad mediante silenciamiento génico post-transcripcional (SGPT). Para ello hemos desarrollado dos construcciones genéticas tipo horquilla. Ambas construcciones bajo el control del promotor 35S del Virus del mosaico de la coliflor y el terminador Nos del gen de la Nopalina sintasa de Rhizobium radiobacter (Agrobacterium tumefaciens). Fragmentos de epicotilos de Citrus macrophylla fueron transformados con cada construcción genética mediante Rhizobium radiobacter cepa EHA105. Los explantes transformados regeneraron brotes en presencia de kanamicina como agente de selección. A la fecha hemos obtenido brotes que muestran la presencia del transgén. En un futuro próximo las plantas de C. macrophylla transformadas serán desafiadas con aislados chilenos del virus para evaluar su resistencia.

Evaluación de parámetros de calidad de suelo sensibles a cambios de uso, en un Andisol

1,2Moreno, M.; 1Carrasco, J.; 1,3Valle, S. 1 Instituto de Ingeniería Agraria y Suelos, Facultad de Ciencias Agrarias, Universidad Austral de Chile, Chile 2 Escuela de Graduados, Facultad de Ciencias Agrarias, Universidad Austral de Chile, Chile 3Centro de Investigación en Suelos Volcánicos, Universidad Austral de Chile, Chile E-Mail: mauryciomoreno@yahoo.com

Las principales variables propuestas para evaluar el índice de calidad del suelo (ICS) en la literatura no son completamente aplicables en suelos derivados de ceniza volcánica. Estos suelos poseen propiedades particulares que muestran grandes variaciones entre los valores de las propiedades utilizadas como ICS, de suelos derivados de materiales no volcánicos. El siguiente estudio plantea definir ICS sensibles a cambios debido al uso del suelo, en un Andisol (Trumao), además de definir sus rangos de variación. Se realizó un muestreo en un suelo Typic Hapludand ubicado en el Centro Experimental INIA La Pampa, Región de Los Lagos (40° 51′ 33″ S, 73° 09′ 28″ O), lugar donde se seleccionaron tres diferentes usos de suelos: bosque nativo (BN), pradera (P) y cultivo (C). Se extrajeron muestras a dos profundidades P1 (0 – 15 cm) y P2 (15 – 30 cm), para análisis químicos y físicos. Se realizaron los siguientes análisis: bases de intercambio (Ca+2, Mg+2 , Na+ , K+ ), Al intercambiable y extractable, materia orgánica (MO), pHagua, pHCaCl2 , P-Olsen, N disponible, densidad aparente (Da) y curva de retención de agua (pF). Los resultados preliminares de este estudio muestran que hay variaciones debido al cambio de uso de suelo desde bosque nativo a Pradera y de pradera a cultivo. Las principales variaciones químicas presentan un aumento ICS de P-Olsen, Na, Al-intercambiable, porcentaje de saturación de Al y disminución de pH y MO. Por otra parte, se produjo un aumento en la Da desde P a C y en la pF se muestra una disminución de los meso-poros y aumento de la micro-porosidad evidenciando una redistribución de la porosidad total. Los resultados preliminares de este estudio, estarían mostrando algunos ICS sensibles al cambio de uso de suelo.

Prospección de hongos causantes de pudriciones en almacenaje de Phaseolus vulgaris L. var. Tórtola, ofrecidos en el mercado local de Valdivia, Región de los Ríos

1 Beluzan, F.; 2 Andrade, N. 1 Escuela de Agronomía, Facultad de Ciencias Agrarias Universidad Austral de Chile, Valdivia, Chile 2 Instituto de Producción y Sanidad Vegetal, Facultad de Ciencias Agrarias Universidad Austral de Chile, Valdivia, Chile E-Mail: franciscobeluzan@gmail.com

El poroto (Phaseolus vulgaris L.) es una legumbre, con 28.000 ton producidas anualmente en Chile, concentrada en zona centro del país. El 85% es consumido internamente y el 15% es exportado. El aumento de precios pagados a productores en los últimos años, ha aumentado el interés por el manejo del cultivo y almacenaje, caracterizado por ser largo y precario. La falta de tecnologías en el manejo de la cosecha, favorece el desarrollo de hongos y bacterias, causando pérdidas a nivel de productor y posibles problemas alimenticios a nivel de consumidor. Las pérdidas por pudriciones en almacenaje, ha generado un interés por la determinación de estos microorganismos para su control. La hipótesis planteada para esta investigación fue que las distintas formas de almacenaje de porotos, en el retail valdiviano, condicionan diferencias en la carga fúngica de patógenos sobre estos. El objetivo general fue identificar y cuantificar la incidencia de los principales agentes causantes de pudriciones en almacenaje de Phaseolus vulgaris var. Tórtola. Se establecieron cámaras húmedas para el desarrollo de los hongos presentes en las muestras recolectadas para tres puntos de venta (retail) de la ciudad de Valdivia (supermercado, fruterías y ferias) en 2011, a los cuales se les aplicaron dos tratamientos: desinfectados y sin desinfectar, con tres repeticiones. Resultados se analizaron por medio de ANOVA y comparados con Tukey al 95%. Se identificaron cuatro géneros causando pudriciones: Penicillium sp., Cladosporium sp., Aspergillus sp. y Botrytis sp. El primero con incidencia del 40%, el segundo con un 15%, el tercero con un 10% y el último con 1%, respectivamente. Los porotos vendidos en ferias y fruterías presentaron elevada carga fúngica (40% incidencia) contrastando con los de supermercados (20% incidencia). Como conclusión se identificaron cuatro géneros de hongos generando pudriciones en almacenaje, logrando hasta un 40% de incidencia de pudriciones en almacenaje.

Monilinia fructicola causando pudrición de poscosecha en ciruelas en Chile

Díaz, G.1 ; Zoffoli, J.; Naranjo, P.; Ferrada, E.; Valencia, A.; Torres, R.; Latorre, B. Facultad de Agronomía e Ingeniería Forestal, Pontificia Universidad Católica de Chile, Santiago, Chile 1 E-Mail: gadiaz3@uc.cl

En otoño de 2013, frutos de ciruelo japonés (Prunus salicina) de cvs. Angelino y Black-Kat desarrollaron una inusual pudrición parda después de 2 meses de almacenamiento en frío de (0° C), que comprendieron cerca del 1% de los frutos. Los frutos se cosecharon en huertos ubicados en San Francisco de Mostazal (33° 59'S), en la VI Región de Chile. Con el objetivo de Identificar el agente causal, se tomaron pequeños trozos desde los márgenes de las lesiones de los frutos seleccionados con síntomas de pudrición parda, se colocaron en placas de Petri con agar-papadextrosa acidificado (APDA) durante 5 días a 20 °C. Después del tiempo de incubación, se observaron colonias grisáceas con márgenes difusos y anillos concéntricos de esporulación. Conidias unicelulares, hialinas, en forma de limón de 14,9 X 9,4 micras de tamaño y en cadenas ramificadas se observaron. Este hongo se identificó como Monilinia fructicola. La identificación se confirmó molecularmente (región ITS1-5.8S-ITS2 del ADNr) utilizando los partidores ITS1 e ITS4. Los análisis de BLAST y filogenéticos confirmaron la identificación de M. fructicola. Los postulados de Koch se cumplieron mediante la reproducción de síntomas de pudrición parda en frutos de ciruelas cv. Angelino (n = 8) que se inocularon con conidias o micelio. Después de 2 días en cámaras húmedas (> 80% de HR) a 25 ° C, en la fruta inoculada se desarrollaron síntomas de pudrición parda, mientras que la fruta control permaneció sana. La presencia de M. fructicola se confirmó morfológicamente en 100% de los frutos sintomáticos. Hasta donde sabemos, este es el primer reporte que demuestra la presencia de M. fructicola causando pudrición parda en frutos de ciruelo japonés durante la poscosecha, después de su primera intercepción en 2009 en Chile, lo que sugiere que este patógeno se ha establecido en el campo.

Incorporación del marcador molecular 57R como marcador de rutina para la detección del gen H1 de resistencia a nemátodo dorado en genotipos pertenecientes al Programa de Mejoramiento Genético de Papa del INIA

1 Folch, C.; Vargas, R.; 1Winkler, A.; 2Rodríguez, F.; 1 Kalazich, J. 1 Programa de Mejoramiento Genético de Papa (PMGP), Instituto de Investigaciones Agropecuarias, Centro Regional de Investigación Remehue 2Centro Internacional de la Papa (CIP), Lima, Perú E-Mail: cfolch@inia.cl

La papa (S. tuberosum L) es el 4to alimento de mayor relevancia en la dieta mundial. El nemátodo dorado (ND), es una de las plagas más dañinas para este cultivo en el mundo siendo considerada una plaga cuarentenaria, y está presente en Chile en forma endémica en las regiones de Coquimbo, Valparaíso y Maule, y últimamente se han encontrado focos de ND en pequeñas huertas en Los Ríos y Los Lagos, que han sido cuarentenados. De ahí que contar con variedades resistentes al ND es trascendental para su control en el norte, y contención en áreas cuarentenarias. El PMGP del INIA ha venido desarrollando variedades con resistencia al ND desde hace tiempo (Yagana-INIA; Karu-INIA; Pueyehue-INIA), y para ello ha estado utilizando selección asistida por el marcador TG689 para detección del gen H1 (para resistencia a patotipos Ro1 y Ro4), que tiene la limitación de no amplificar en algunas variedades resistentes, como es el caso de Eva y otras. El objetivo de este trabajo fue la estandarización del nuevo marcador SCAR 57R para detección del gen H1. Las secuencias del marcador 57R, y los protocolos de amplificación fueron reportados por Finkers y cols. (2011), en su estandarización se utilizaron variedades susceptibles (Ona-INIA y Desireè) y resistentes (Eva y Granola), lográndose en ésta última la amplificación de un producto de PCR de aproximadamente 450 pb. Se analizó la presencia de H1 en 112 genotipos con ambos marcadores. Con el marcador 57R fue posible identificar un mayor número de genotipos portadores de H1 (44) comparado con el marcador TG689 (39), sin embargo en un genotipo el gen H1 fue exclusivamente reconocido por TG689. De los resultados podemos concluir que para la identificación del gen H1 de resistencia a ND se recomienda utilizar ambos marcadores, ya que nos entregan resultados complementarios.

Variabilidad genética de aislamientos de Macrophomina phaseolina (Tassi) Goid. colectados desde viveros y plantaciones de Pinus radiata D. Don en la Región del Bíobío

Espinoza, G.; Sanfuentes, E.; Hasbún, R. Facultad de Ciencias Forestales, Centro de Biotecnología, Universidad de Concepción, Concepción, Chile E-Mail: Gianespinoza@udec.cl

El patógeno de suelo Macrophomina phaseolina, es el agente causal de la enfermedad pudrición carbonosa de la raíz en más de 500 cultivos y especies silvestres. Este patógeno causa pudrición del tallo y raíz en especies herbáceas y leñosas. En Chile, fue detectado en el año 1983 en viveros de Pinus radiata, y desde entonces, se ha convertido en un importante problema sanitario para el sector forestal. Actualmente, a nivel mundial existe escasa información acerca de la diversidad genética de esta especie, descrita como monotípica y polimórfica. En nuestro país, se han realizado algunos estudios en base a la caracterización morfológica y patogénica, además del control físico y biológico de M. phaseolina. Considerando que el conocimiento de la variabilidad genética del patógeno, aportaría al desarrollo de variedades resistentes y métodos de control más amigables con el medio ambiente, éste trabajo tiene por objetivo explorar preliminarmente la variabilidad genética presente en aislamientos de M. phaseolina obtenidos desde P. radiata y otras especies leñosas. Se utilizaron ocho aislamientos (de un total de 40 aislados) para establecer las condiciones experimentales que permiten obtener resultados informativos y reproducibles sobre la diversidad genética de esta especie usando la caracterización morfológica y molecular mediante AFLP. La caracterización morfológica fue determinada en base a la descripción de colonias (color del micelio, presencia/ausencia de micelio aéreo, y tamaño de microesclerocios). En el caso de los AFLP, se realizó la respectiva extracción de ADN de calidad a partir de micelio y se aplicó un protocolo de AFLP optimizado para análisis mediante electroforesis capilar. Se utilizó un total de doce combinaciones de partidores selectivos, de los cuales se seleccionaron las tres más informativas y con tasas de error de genotifipicación menores al 1%.

XXIV Congreso de la Sociedad Chilena de Fitopatología (Diciembre 2015)

El Centro Regional de Investigación La Platina del Instituto de Investigaciones Agropecuarias (INIA), tiene el agrado de invitar a usted a participar en el XXIV Congreso de la Sociedad Chilena de Fitopatología a desarrollarse en el centro de eventos Conference Town en la ciudad de Viña del Mar, durante los días 1, 2 y 3 de diciembre 2015.

Seguir leyendo →

Invitacion Curso de Post Grado (Marzo 2014)

Dirección de Postgrado de la Facultad de Agronomía, Universidad de Concepción tiene el agrado de invitarle a participar del curso Dictado por el Docente invitado Gary Secor, Ph.D., Department of Plant Pathology, North Dakota State University, Fargo, USA.

Seguir leyendo →

XXII Congreso

23, 24, 25 y 26 Septiembre, Viña del Mar. Considerando la importancia de Chile como potencia agro alimentaria, la relevancia de dar valor agregado a nuestros productos agropecuarios, el notable impacto de la investigación en biotecnología no solo para la academia sino también en otorgar aplicaciones prácticas en la industria, plantea constantes desafíos los que son abordados por diferentes instituciones que realizan investigación...

Seguir leyendo →

Síguenos

Obtener el boletín de noticias